Total synthesis of lipid A, active principle of bacterial endotoxin.

Imoto, Masahiro; Yoshimura, Hidetoshi; Kusumoto, Shoichi; Shiba, Tetsuo

doi:10.2183/pjab.60.285

Cited by 80 publications

(52 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Taxol was obtained from Wako (Osaka, Japan), and stored at -80°C as a 10 mM stock solution in DMSO. Compound 506 was chemically synthesized as described previously [46] and then dissolved at a concentration of 2 mg/ml in a 0.1% triethylamine aqueous solution. Phosphorothioate-stabilized CpG DNA (TCCATGACGTTCCTGATGCT) [36] was obtained from Rikaken (Nagoya, Japan).…”

Section: Reagentsmentioning

confidence: 99%

Treponemal glycoconjugate inhibits Toll‐like receptor ligand‐induced cell activation by blocking LPS‐binding protein and CD14 functions

2003

View full text Add to dashboard Cite

Spirochetes are well-known as causative agents of various chronic infectious diseases. Glycolipids of small-sized Treponema spirochetes have been shown to exhibit immunostimulating activities. In this study, we found that a glycoconjugate preparation obtained from Treponema medium (Tm-Gp), an intermediate-sized oral Treponema seen in subgingival plaque from patients with chronic periodontal diseases, diminished the LPS-induced activation of a human monocytic cell line, while TNF- § -induced activation was unaffected. NF-‹ B activation in Ba/F3 cells expressing murine Toll-like receptor (TLR) 4 and MD-2 was inhibited by Tm-Gp in a CD14/LPS-binding protein (LBP)-dependent manner when stimulated with LPS or its active center lipid A but not when stimulated with Taxol. Tm-Gp blocked the binding of LPS to immobilized CD14 and LBP and inhibited nitric oxide (NO) production by a murine M ¤ cell line following stimulation with peptidoglycan and LPS in the presence of FBS, while NO production in response poly (I:C) RNA or CpG DNA remained unaffected. The inhibitory effects of Tm-Gp seem to be attributable to the lipophilic portion of the glycoconjugate. These results indicate that T. medium contains a glycoconjugate possessing an inhibitory effect on TLR-mediated cell activation through interaction with LBP and CD14.

show abstract

Section: Reagentsmentioning

confidence: 99%

Treponemal glycoconjugate inhibits Toll‐like receptor ligand‐induced cell activation by blocking LPS‐binding protein and CD14 functions

2003

View full text Add to dashboard Cite

show abstract

“…The chemical synthesis of E. coli lipid A has recently been described [14]. Structurally it corresponds to the anticipated formula of bacterial free E. coli lipid A (Fig.…”

Section: Synthetic Lipid Amentioning

confidence: 99%

“…A compound structurally corresponding to free E. coli lipid A has recently been synthesized [14]. Here, we report on results obtained with the synthetic lipid A preparation in comparison with bacterial free E. coli lipid A in various in vitro and in vivo endotoxin test systems.…”

mentioning

confidence: 99%

Synthetic and natural Escherichia coli free lipid A express identical endotoxic activities

Galanos¹,

Lüderitz²,

Rietschel³

et al. 1985

European Journal of Biochemistry

Self Cite

452

262

View full text Add to dashboard Cite

The recently chemically synthesized Escherichia coli lipid A and the natural free lipid A of E. coli were compared with respect to their endotoxic activities in the following test systems: lethal toxicity, pyrogenicity, local Shwartzman reactivity, Limulus amoebocyte lysate gelation capacity, tumour necrotizing activity, B cell mitogenicity, induction of prostaglandin synthesis in macrophages, and antigenic specificity. It was found that synthetic and natural free lipid A exhibit identical activities and are indistinguishable in all tests.Lipopolysaccharides (endotoxins) of gram-negative bacteria which consist of a heteropolysaccharide and a lipid component (termed lipid A) elicit multiple acute pathophysiological effects such as fever, lethality, Shwartzman reactivity, macrophage and B-lymphocyte activation, and other activities [I]. In 1954 it was proposed that for the induction of these effects the polysaccharide portion is dispensable and that the lipid A component represents the active center responsible for the endotoxic properties of lipopolysaccharides [2]. Evidence for this was then obtained in numerous investigations [2 -41 and this concept is now generally accepted.The chemical structure of the lipid A component of several enterobacterial lipopolysaccharides has been analysed during recent years in great detail (for reviews see [5, 61) and it was recognized that lipid A of Escherichiu coli possesses a comparatively simple structure. Free E. coli lipid A consists of a 8(1-6)-linked D-glucosamine disaccharide which is substituted by two phosphoryl groups, one being bound to position 4' of the nonreducing glucosamine residue (GlcN 11) and one being a-linked [7] to the glycosidic hydroxyl group of the reducing glucosaminyl group (GlcN I) (Fig.

show abstract

“…E. coli O55 LPS and S. minnesota R60 (Rachemotype) LPS were obtained from List Biological Laboratories, Campbell, CA, USA. Synthetic E. colitype lipid A (compound 506) [11] was provided by Daiichi Pharmaceutical, Tokyo, Japan.…”

Section: Lps and Lipid Amentioning

confidence: 99%

Biological activities of lipopolysaccharides of Proteus spp. and their interactions with polymyxin B and an 18-kDa cationic antimicrobial protein (CAP18)-derived peptide

Świerzko¹,

Kirikae

et al. 2000

Journal of Medical Microbiology

Self Cite

View full text Add to dashboard Cite

The saccharide constituents of lipopolysaccharides (LPS) of Proteus spp. vary with the strain and contain unique components about which little is known. The biological activities of LPS and lipid A from S-and R-forms of 10 Proteus strains were examined. LPS from all S-form Proteus strains was lethal to D-(þ)-galactosamine (GalN)-loaded, LPS-responsive, C3H=HeN mice, but not to LPS-hypo-responsive C3H=HeJ mice. P. vulgaris O25 LPS evoked strong anaphylactoid reactions in N-acetylmuramyl-L-alanyl-Disoglutamine (MDP)-primed C3H=HeJ mice. LPS from S-and R-form Proteus strains induced production of nitric oxide (NO) and tumour necrosis factor (TNF) by macrophages isolated from C3H=HeN but not C3H=HeJ mice. Lipid A from Proteus strains also induced NO and TNF production, although lipid A was less potent than LPS. The effects of LPS were mainly dependent on CD14; LPS-induced NO and TNF production in CD14 þ J774.1 cells was significantly greater than in CD14 À J7.DEF.3 cells. All LPS from Proteus strains, and especially from P. vulgaris O25, exhibited higher anticomplementary activity than LPS from Escherichia coli or Pseudomonas aeruginosa. Polymyxin B inactivated proteus LPS in a dose-dependent manner, but these LPS preparations were more resistant to polymyxin B than E. coli LPS. CAP18 109-135 , a granulocyte-derived peptide, inhibited proteus LPS endotoxicity only when the LPS:CAP18 109-135 ratio was appropriate, which suggests that CAP18 109-135 acts through a different mechanism than polymyxin B. The results indicate that LPS from Proteus spp. are potently endotoxic, but that the toxicity is different from that of LPS from E. coli or Salmonella spp. and even varies among different Proteus strains. The variation in biological activities among proteus LPS may be due to unique components within the respective LPS.

show abstract

Total synthesis of lipid A, active principle of bacterial endotoxin.

Cited by 80 publications

References 0 publications

Treponemal glycoconjugate inhibits Toll‐like receptor ligand‐induced cell activation by blocking LPS‐binding protein and CD14 functions

Treponemal glycoconjugate inhibits Toll‐like receptor ligand‐induced cell activation by blocking LPS‐binding protein and CD14 functions

Synthetic and natural Escherichia coli free lipid A express identical endotoxic activities

Biological activities of lipopolysaccharides of Proteus spp. and their interactions with polymyxin B and an 18-kDa cationic antimicrobial protein (CAP18)-derived peptide

Contact Info

Product

Resources

About