Topoisomerase I has a strong binding preference for a conserved hexadecameric sequence in the promotor region of the rRNA gene from<i>Tetrahymena pyriformis</i>

Andersen, Anders H.; Gocke, Elmar; Bonven, Bjarne; Nielsen, Ole F.; Westergaard, Ole

doi:10.1093/nar/13.5.1543

Cited by 61 publications

(36 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…It also appears to be catalytically active on transcriptionally active genes in Drosophila polytene chromosomes (15) as well as on nucleolus-associated ribosomal genes (16)(17)(18)(19). These experiments suggest a functional role for the enzyme in transcriptional events involving either RNA polymerase I or II.…”

mentioning

confidence: 80%

Characterization of a mammalian mutant with a camptothecin-resistant DNA topoisomerase I.

Andoh¹,

Ishii²,

Suzuki³

et al. 1987

Proc. Natl. Acad. Sci. U.S.A.

245

110

View full text Add to dashboard Cite

DNA topoisomerase I was purified to near homogeneity from a clonal line of human lymphoblastic leukemia cells, RPMI 8402, that is resistant to camptothecin, a cytotoxic alkaloid from Camptotheca acuminata, and compared with that of the parent wild-type cells. As assayed by relaxation of the supercoiled plasmid DNA and by formation of enzymelinked DNA breaks, the purified enzyme from the resistant cells was shown to be >125-fold as resistant to camptothecin as the wild-type enzyme, comparable to a cellular resistance index of about 300. Therefore, the cellular resistance appears to be due to the resistance of the enzyme. The amount of the immunoreactive enzyme protein in whole extract appeared to be reduced to less than half that of the wild-type enzyme. These results establish that DNA topoisomerase I is the cellular target of camptothecin and that DNA topoisomerase I is essential for the survival of mammalian cells.The DNA topoisomerases are enzymes that catalyze the concerted breakage and rejoining of the DNA backbone and thereby are presumed to participate in various genetic processes (1-5). The type I topoisomerases transiently cut and reseal one DNA strand so that the linking number changes by steps of one. Genetic and functional studies of the enzymes have been largely limited to prokaryotes and the lower eukaryote yeast. Viable mutants ofEscherichia coli defective in the topA gene encoding topoisomerase I were isolated (6, 7), but these proved to have mutations in DNA gyrase genes that compensated for the mutation in topA (8-10). This finding suggested an essential role for the enzyme in regulating the degree of supercoiling of DNA by counteracting the activity of the type II enzyme. In contrast, however, topoisomerase I-deficient mutants of yeast were isolated and shown to be viable, although they possessed the wild-type allele of topoisomerase II (11,12). The effect of the topoisomerase I mutation, however, was manifested by an additional mutation in topoisomerase II, implicating the complementary role of the latter (12).Topoisomerase I was previously found associated with transcriptionally active chromatin in mammalian cells (13,14). It also appears to be catalytically active on transcriptionally active genes in Drosophila polytene chromosomes (15) as well as on nucleolus-associated ribosomal genes (16-19). These experiments suggest a functional role for the enzyme in transcriptional events involving either RNA polymerase I or II.The availability of mutants and specific inhibitors of this enzyme as was the case in prokaryotes might help dissect and establish the role of this enzyme in DNA metabolism. We previously reported that heparin is a potent inhibitor of a mammalian DNA topoisomerase I (20, 21), but its broad specificity limits its usefulness for this purpose. Camptothecin (CPT) is a cytotoxic alkaloid isolated from Camptotheca acuminata (22, 23), which has a strong antitumor activity against a wide range of experimental tumors. CPT inhibits RNA and DNA synthesis and causes rapid and rev...

show abstract

mentioning

confidence: 80%

Characterization of a mammalian mutant with a camptothecin-resistant DNA topoisomerase I.

Andoh¹,

Ishii²,

Suzuki³

et al. 1987

Proc. Natl. Acad. Sci. U.S.A.

245

110

View full text Add to dashboard Cite

show abstract

“…The MUT target duplex contains three mutated base pairs (in bold) in the triplex site so that the TFO can no longer bind. The B2 target is modified on the 3Ј side of the triplex (in bold) in order to abolish Topo I cleavage sites b and c. Duplex TID was obtained by inserting at the 3Ј end of the triplex an 8-bp sequence encompassing a wellknown CPT cleavage site from the rRNA gene of Tetrahymena thermophilus characterized by Westergaard and coworkers (1,25). For all four duplexes, a 324-bp restriction fragment was 32 P radiolabeled and incubated in the presence of the conjugates and Topo I.…”

Section: Downloaded Frommentioning

confidence: 99%

“…To further characterize this feature, we used a duplex containing, instead of sites b and c, a strong CPT cleavage site (in bold) 4 bp from the 3Ј triplex end (distance appropriate for targeting with the TFO-CPT conjugates studied (2, 7), called site B (5Ј GAGAGAGAGAAAAAAACTCCAAGTCT 3Ј/3Ј CTC TCTCTCTTTTTTTGAGGTTCAGA 5Ј] in duplex TID). This site was built from a CPT-sensitive site present in the rRNA gene previously studied by Westergaard and coworkers (1,25). The cleavage pattern in the presence of CPT was, compared to the unmutated target duplex (WT), modified only at the 3Ј side of the triplex site, where site B appeared, located 4 bp from the triplex end (Fig.…”

Section: Downloaded Frommentioning

confidence: 99%

Exploring the Cellular Activity of Camptothecin-Triple-Helix-Forming Oligonucleotide Conjugates

Arimondo

Thomas

Oussedik

et al. 2006

Molecular and Cellular Biology

View full text Add to dashboard Cite

Topoisomerase I is a ubiquitous DNA-cleaving enzyme and an important therapeutic target in cancer chemotherapy for camptothecins (CPTs). These drugs stimulate DNA cleavage by topoisomerase I but exhibit little sequence preference, inducing toxicity and side effects. A convenient strategy to confer sequence specificity consists of the linkage of topoisomerase poisons to DNA sequence recognition elements. In this context, triple-helix-forming oligonucleotides (TFOs) covalently linked to CPTs were investigated for the capacity to direct topoisomerase I-mediated DNA cleavage in cells. In the first part of our study, we showed that these optimized conjugates were able to regulate gene expression in cells upon the use of a Photinus pyralis luciferase reporter gene system. Furthermore, the formation of covalent topoisomerase I/DNA complexes by the TFO-CPT conjugates was detected in cell nuclei. In the second part, we elucidated the molecular specificity of topoisomerase I cleavage by the conjugates by using modified DNA targets and in vitro cleavage assays. Mutations either in the triplex site or in the DNA duplex receptor are not tolerated; such DNA modifications completely abolished conjugate-induced cleavage all along the DNA. These results indicate that these conjugates may be further developed to improve chemotherapeutic cancer treatments by targeting topoisomerase I-induced DNA cleavage to appropriately chosen genes.Topoisomerase I (Topo I) is a ubiquitous nuclear enzyme involved in the control of DNA topology. During the catalytic cycle, the enzyme transiently cleaves DNA and forms a covalent 3Ј-phosphorotyrosyl adduct usually referred to as the cleavage complex (14,28,29). A number of drugs, such as the antitumor alkaloid camptothecin (CPT) (for reviews, see references 17 and 24) and indolocarbazole analogs of the antibiotic rebeccamycin family (9,23,30), act by blocking the religation step after DNA cleavage, thereby enhancing the formation of cleavage complexes (DNA/Topo I/drug ternary complexes), which constitute persistent DNA breaks believed to be responsible for cell death (20)(21)(22)28). Topo I poisons stimulate DNA cleavage at many sites along the double helix with a limited sequence preference (one or two bases around the cleavage site). However, the sequence specificity of the Topo I poison can be considerably enhanced by linkage to a DNA recognition element. Initially, Matteucci et al. (19) showed in vitro that the covalent attachment of CPT to a triple-helix-forming oligonucleotide (TFO) induces site-specific DNA cleavage near the end of the triple helix. In the same context, we showed that CPT and rebeccamycin derivatives covalently linked to a TFO induce Topo I to mediate a sequence-specific DNA cleavage near the triplex site (3, 6, 7) according to a preferred geometry (2). The use of triple-helical DNA structures offers an efficient strategy to target Topo I to specific DNA sequences. Consequently, TFO-drug conjugates may be potentially exploited to improve the efficacy and selectivity of chemo...

show abstract

“…First, the vaccinia enzyme is not inhibited by camptothecin (10), a plant alkaloid that inhibits the cellular enzymes by slowing the religation step of catalysis (11)(12)(13)(14). Furthermore, the vaccinia enzyme cleaves DNA at a unique recognition sequence (15)(16)(17), while the cellular enzymes, although they will cleave at specific sequences (18,19), have only a limited sequence preference (14, 20 -25).…”

mentioning

confidence: 99%

“…The oligonucleotide (Fig. 4C) contained the hexadecameric sequence from the rDNA of Tetrahymena plus upstream and downstream base pairs that are known to be important for maximal Topo I cleavage of this high affinity binding site (18,19,(32)(33)(34)(35)(36). The results demonstrate that, as with the plasmid DNA, cleavage of full-length Topo I to generate the ϳ73-kDa fragment was only slightly inhibited (Ͻ2-fold) by the presence of the duplex oligonucleotide (compare lanes 3-6 to lanes 12-15 of panel A).…”

mentioning

confidence: 99%

The Domain Organization of Human Topoisomerase I

Stewart¹,

Ireton

Champoux

1996

Journal of Biological Chemistry

162

156

View full text Add to dashboard Cite

Using limited proteolysis, we show that the domain boundaries of human topoisomerase I closely parallel those predicted from sequence comparisons with other cellular Topo I enzymes. The enzyme is comprised of (i) an NH 2 -terminal domain (ϳ24 kDa), which is known to be dispensable for activity, (ii) the core domain (ϳ54 kDa), (iii) a linker region (ϳ3 kDa), and (iv) the COOHterminal domain (ϳ10 kDa), which contains the active site tyrosine. The highly conserved core and COOH-terminal domains are resistant to proteolysis, while the unconserved NH 2 -terminal and linker domains are sensitive. Noncovalent binding of Topo I to plasmid DNA or to short duplex oligonucleotides decreases the sensitivity of the linker to proteolysis by approximately a factor of 10 but has no effect on proteolysis of the NH 2 -terminal domain. When the enzyme is covalently complexed to an 18 base pair single-stranded oligonucleotide, the linker region is sensitive to proteolysis whether or not duplex DNA is present. The net positive charge of the linker domain suggests that at a certain point in catalysis the linker may bind directly to DNA. Further, we show that limited subtilisin cleavage can generate a mixture of 60-kDa core and ϳ10-kDa COOH-terminal fragments, which retain a level of topoisomerase activity that is nearly equal to undigested control samples, presumably because the two fragments remain associated after proteolytic cleavage. Thus, despite its potential role in DNA binding, the linker domain (in addition to the NH 2 -terminal domain) appears to be dispensable for topoisomerase activity. Finally, the limited proteolysis pattern of the human enzyme differs substantially from the limited proteolysis pattern of the vaccinia viral Topo I, indicating that the two enzymes belong to separate eukaryotic topoisomerase I subfamilies. This results in the formation of a phosphotyrosine bond between the enzyme and the 3Ј end of the broken strand. Reversal of the transesterification reaction restores the phosphodiester bond and liberates the enzyme. Two models, free rotation and enzyme-bridging, have been proposed to explain the mechanism by which Topo I promotes topoisomerization of the DNA (reviewed in Ref. 1). The free rotation model proposes that the 5Ј end of the broken strand is released from the active site and is allowed to freely rotate about the unbroken strand. The enzyme-bridging model proposes that the unbroken strand is passed through an enzyme-bridged break, formed by covalent attachment to the 3Ј end of the broken strand and noncovalent binding to the 5Ј end of the broken strand.Sequence comparisons of the cellular eukaryotic Topo I enzymes 2 reveals the human enzyme (765 residues, 91 kDa) can be divided into four domains (see preceding paper (5) 2 In the accompanying paper (5) we demonstrate that the NH 2 -terminal domain is mostly if not completely unstructured, an observation that is consistent with the fact that this domain is sensitive to proteolysis and is dispensable for activity (5-9).Weak amino acid sequence hom...

show abstract

Topoisomerase I has a strong binding preference for a conserved hexadecameric sequence in the promotor region of the rRNA gene fromTetrahymena pyriformis

Cited by 61 publications

References 23 publications

Characterization of a mammalian mutant with a camptothecin-resistant DNA topoisomerase I.

Characterization of a mammalian mutant with a camptothecin-resistant DNA topoisomerase I.

Exploring the Cellular Activity of Camptothecin-Triple-Helix-Forming Oligonucleotide Conjugates

The Domain Organization of Human Topoisomerase I

Contact Info

Product

Resources

About