Topographical transcriptome mapping of the mouse medial ganglionic eminence by spatially resolved RNA-seq

Abstract

BackgroundCortical interneurons originating from the medial ganglionic eminence, MGE, are among the most diverse cells within the CNS. Different pools of proliferating progenitor cells are thought to exist in the ventricular zone of the MGE, but whether the underlying subventricular and mantle regions of the MGE are spatially patterned has not yet been addressed. Here, we combined laser-capture microdissection and multiplex RNA-sequencing to map the transcriptome of MGE cells at a spatial resolution of 50 μm.ResultsDistinct groups of progenitor cells showing different stages of interneuron maturation are identified and topographically mapped based on their genome-wide transcriptional pattern. Although proliferating potential decreased rather abruptly outside the ventricular zone, a ventro-lateral gradient of increasing migratory capacity was identified, revealing heterogeneous cell populations within this neurogenic structure.ConclusionsWe demonstrate that spatially resolved RNA-seq is ideally suited for high resolution topographical mapping of genome-wide gene expression in heterogeneous anatomical structures such as the mammalian central nervous system.Electronic supplementary materialThe online version of this article (doi:10.1186/s13059-014-0486-z) contains supplementary material, which is available to authorized users.

A probabilistic model-based bi-clustering method for single-cell transcriptomic data analysis

“…All the four spatial clusters with distinct expression patterns by cell cycle, cell morphogenesis and neuron development genes, as reported in the original study, were identified by our biclustering and pathway-enrichment analysis ( Figure 3A, 3C) [25]. In addition, our method discovered more distinctions across the four clusters as follows: cytokine-cytokine receptor, mitochondrial fatty acid beta oxidation, phospholipid metabolism, telomere maintenance, galactose metabolism, histidine metabolism, O-linked glycosylation, ribosome, spliceosome, and circadian.…”

“…We applied our analysis pipeline on three recently published datasets: (1) GSE48968, a single-cell RNA-Seq time-course dataset of 1,700 primary mouse dendritic cells treated with three pathogenic agents and multiple control experiments [24]; (2) GSE57872, a single cell RNA-Seq dataset of 430 glioblastoma cells isolated from five distinct tumors with known clinical information [12]; and (3) GSE60402, an bRNA-Seq dataset of laser-capture microdissected tissue cubes from the medial ganglionic eminence of wild-type and GFRa1 mutant mice where each cube containing ~100 cells was treated as a single cell with detailed spatial coordinates [25]. More detailed information on the three datasets could be found in the Material and Methods section.…”

Thalamo-cortical axons regulate the radial dispersion of neocortical GABAergic interneurons

“…Riboprobe synthesis and in situ hybridization followed by immunohistochemistry were performed as described in (Zechel et al, 2014). Riboprobes were derived from DNA fragments obtained by PCR from neonatal cortical cDNA using the following primers: Cux1 (fw: CTCAGAAAGCACTCCAAAGACC; rev: CTTCCAGCTTGAATCTCCTCAA); CTGF (fw: AAATGCTGCGAGGAGTGG; rev: TGTGCGTTCTGGCACTGT); Lmo4 (fw: GCTCCCTCTCCTGGAAGC; rev: GGGGCCCTGCTAATTGTT); RORß (fw: ACCTGAACACCGAGACCG; rev: CCCTTCATTTGCAGACCG).…”

Topographical transcriptome mapping of the mouse medial ganglionic eminence by spatially-resolved RNA-seq

“…Riboprobes were derived from DNA fragments obtained by PCR from E12.5 MGE cDNA using the primers listed in Additional file 4. Riboprobe synthesis and in situ hybridization were essentially carried out as previously described [48] with a few modifications. After incubation with anti DIG antibody, sections were washed three times for 5 minutes in phosphate-buffered saline (PBS), followed by a wash in maleic acid plus Tween 20 (MABT) for 30 minutes.…”