Toll-like Receptor 5 Activation by the CagY Repeat Domains of Helicobacter pylori

Tegtmeyer, Nicole; Neddermann, Matthias; Lind, Judith; Pachathundikandi, Suneesh Kumar; Sharafutdinov, Irshad; Gutiérrez-Escobar, Andrés Julián; Brönstrup, Mark; Tegge, Werner; Hong, Minsun; Rohde, Manfred; Delahay, Robin M; Sticht, Heinrich; Backert, Steffen

doi:10.1016/j.celrep.2020.108159

Cited by 40 publications

(31 citation statements)

References 76 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This PCR fragment was subsequently cloned into the pGEM‐T plasmid (Promega). The gmhA gene was then opened by PCR using primers 973F (5’‐AACGATGTTTTGATAGGGATTTC) and 973R (5’‐TTTTACCCCCAACGCTTCCAC) followed by ligation of the chloramphenicol resistance gene cassette ( cat R , about 1 kb Eco RV/ Sma II fragment) obtained from plasmid pTnMax1 (Backert et al , 2000 ), which was fused to an rpsL cassette, resulting in streptomycin‐sensitive ( rpsL encodes dominant streptomycin sensitivity) and chloramphenicol‐resistant transformants as described (Tegtmeyer et al , 2020 ). This construct was then used to mutagenize H. pylori by natural transformation and double cross‐over recombination according to standard procedures (Moese et al , 2001 ).…”

Section: Methodsmentioning

confidence: 99%

TIFA has dual functions in Helicobacter pylori ‐induced classical and alternative NF‐κB pathways

et al. 2021

Self Cite

View full text Add to dashboard Cite

Helicobacter pylori infection constitutes one of the major risk factors for the development of gastric diseases including gastric cancer. The activation of nuclear factor‐kappa‐light‐chain‐enhancer of activated B cells (NF‐κB) via classical and alternative pathways is a hallmark of H. pylori infection leading to inflammation in gastric epithelial cells. Tumor necrosis factor receptor‐associated factor (TRAF)‐interacting protein with forkhead‐associated domain (TIFA) was previously suggested to trigger classical NF‐κB activation, but its role in alternative NF‐κB activation remains unexplored. Here, we identify TRAF6 and TRAF2 as binding partners of TIFA, contributing to the formation of TIFAsomes upon H. pylori infection. Importantly, the TIFA/TRAF6 interaction enables binding of TGFβ‐activated kinase 1 (TAK1), leading to the activation of classical NF‐κB signaling, while the TIFA/TRAF2 interaction causes the transient displacement of cellular inhibitor of apoptosis 1 (cIAP1) from TRAF2, and proteasomal degradation of cIAP1, to facilitate the activation of the alternative NF‐κB pathway. Our findings therefore establish a dual function of TIFA in the activation of classical and alternative NF‐κB signaling in H. pylori‐infected gastric epithelial cells.

show abstract

Section: Methodsmentioning

confidence: 99%

TIFA has dual functions in Helicobacter pylori ‐induced classical and alternative NF‐κB pathways

et al. 2021

Self Cite

View full text Add to dashboard Cite

show abstract

“…For the infection experiments, H. pylori cag PAI‐positive wt strains N6, NCTC11637, P12, 26‐695 and G27 and cag PAI‐negative wt strains UH4, Ka125, Safr7 and 1061 were used (Backert et al, 2004; Conradi et al, 2012; Tegtmeyer et al, 2020). In addition, a set of isogenic H. pylori mutants was applied, including P12Δ vacA , P12Δ slt , P12Δ gmhA , P12Δ cagA , P12Δ cagY and P12Δ cagL (Pachathundikandi et al, 2019; Tegtmeyer et al, 2020). The H. pylori strains were stored as glycerol stocks at −80°C.…”

Section: Methodsmentioning

confidence: 99%

TheHelicobacter pyloritypeIVsecretion system upregulates epithelial cortactin expression by aCagA‐ andJNK‐dependent pathway

Sharafutdinov

Backert

Tegtmeyer

2021

Cellular Microbiology

Self Cite

View full text Add to dashboard Cite

Cortactin represents an important actin‐binding factor, which controls actin‐cytoskeletal remodelling in host cells. In this way, cortactin has been shown to exhibit crucial functions both for cell movement and tumour cell invasion. In addition, the cortactin gene cttn is amplified in various cancer types of humans. Helicobacter pylori is the causative agent of multiple gastric diseases and represents a significant risk factor for the development of gastric adenocarcinoma. It has been repeatedly shown that H. pylori manipulates cancer‐related signal transduction events in infected gastric epithelial cells such as the phosphorylation status of cortactin. In fact, H. pylori modifies the activity of cortactin's binding partners to stimulate changes in the actin‐cytoskeleton, cell adhesion and motility. Here we show that H. pylori infection of cultured AGS and Caco‐2 cells for 24–48 hr leads to the overexpression of cortactin by 2–3 fold at the protein level. We demonstrate that this activity requires the integrity of the type IV secretion system (T4SS) encoded by the cag pathogenicity island (cagPAI) as well as the translocated effector protein CagA. We further show that ectopic expression of CagA is sufficient to stimulate cortactin overexpression. Furthermore, phosphorylation of CagA at the EPIYA‐repeat region is not required, suggesting that this CagA activity proceeds in a phosphorylation‐independent fashion. Inhibitor studies further demonstrate that the involved signalling pathway comprises the mitogen‐activated protein kinase JNK (c‐Jun N‐terminal kinase), but not ERK1/2 or p38. Taken together, using H. pylori as a model system, this study discovered a previously unrecognised cortactin activation cascade by a microbial pathogen. We suggest that H. pylori targets cortactin to manipulate the cellular architecture and epithelial barrier functions that can impact gastric cancer development. Take Aways Helicobacter pylori infection induces overexpression of cortactin at the protein level Cortactin upregulation requires the T4SS and effector protein CagA Ectopic expression of CagA is sufficient to stimulate cortactin overexpression Overexpression of cortactin proceeds CagA phosphorylation‐independent The involved host cell signalling pathway comprises the MAP kinase JNK

show abstract

“…Pro-inflammatory [8,31] TLR9 HP DNA After DNA transfer via T4SS, epithelial cells induce MAPK after both CREB and AP-1 site binding, which leads to COX-2-dependent release of PGE2; this may result in DU or GC. However, upregulation of IL-17 and TH17 and IFN release also suppresses inflammation.…”

Section: Tlr5 Rs5744174mentioning

confidence: 99%

“…Progressive research during recent years has presented strong evidence of how HP virulence factors affect the host immune system. These factors are in addition to the widely studied lipopolysaccharides (LPS) and flagellin such as cyclooxygenase-2 (COX-2) production through TLR2 [6], activation of TLR5 by CagL and CagY [7,8], TLR9 activation upon translocation of DNA via a type IV secretion system (T4SS) [9], which largely reflect the pathogenesis of PUD and gastric cancer. Furthermore, the association of TNF-a and IL-1b levels in the presence and absence of Helicobacter pylori infection is linked to an increased risk of peptic ulcer development [10].…”

Section: Introductionmentioning

confidence: 99%

The role of toll-like receptors in peptic ulcer disease

Jin

Nepal

Gao

2021

Immunological Medicine

View full text Add to dashboard Cite

Helicobacter pylori (HP) is the primary etiologic factor that induces events in the immune system that lead to peptic ulcers. Toll-like receptors (TLRs) are an important part of the innate immune system, as they play pivotal roles in pathogen-associated molecular pattern (PAMP) recognition of HP as well host-associated damage-associated molecular patterns (DAMPs). Recent advancements such as COX-2 production, LPS recognition through TLR2, CagL, and CagY protein of HP activating TLR5, TLR9 activation via type IV secretion system (T4SS) using DNA transfer, TLR polymorphisms, their adaptor molecules, cytokines, and other factors play a significant role in PUD. Thus, some novel PUD treatments including Chuyou Yuyang granules, function by TLR4/NF-jB signaling pathway suppression and TNF-a and IL-18 inhibition also rely on TLR signaling. Similarly glycyrrhetinic acid (GA) treatment activates TLR-4 in Ana-1 cells not via TRIF, but via MYD88 expression, which is significantly upregulated to cure PUD. Therefore, understanding TLR signaling complexity and its resultant immune modulation after host-pathogen interactions is pivotal to drug and vaccine development for other diseases as well including cancer and recent pandemic COVID-19. In this review, we summarize the TLRs and HP interaction; its pathophysiology-related signaling pathways, polymorphisms, and pharmaceutical approaches toward PUD.

show abstract

Toll-like Receptor 5 Activation by the CagY Repeat Domains of Helicobacter pylori

Cited by 40 publications

References 76 publications

TIFA has dual functions in Helicobacter pylori ‐induced classical and alternative NF‐κB pathways

TIFA has dual functions in Helicobacter pylori ‐induced classical and alternative NF‐κB pathways

TheHelicobacter pyloritypeIVsecretion system upregulates epithelial cortactin expression by aCagA‐ andJNK‐dependent pathway

The role of toll-like receptors in peptic ulcer disease

Contact Info

Product

Resources

About