TNFα-induced NF-κB activation and cell oxidant production are modulated by hexameric procyanidins in Caco-2 cells

NF-κB Transcriptional Activity Is Modulated by FK506-binding Proteins FKBP51 and FKBP52

“…On the other hand, the overexpression of FKBP52 does not affect the nuclear import rate of RelA but significantly increases the nuclear retention time of the transcription factor. The rapid cycling to the cytoplasm of NF-B observed in control cells after 30 min agrees with previously reported data (9,34,41,42), whereas both effects of the immunophilins, i.e. the nuclear translocation rate and nuclear retention time of the associated cargo, are quite similar to those previously reported for steroid receptors (14).…”

“…Electrophoretic Mobility Shift Assays (EMSA)-Nuclear fractions of HEK 293-T cells were isolated as previously described (34). An oligonucleotide containing the consensus sequence of NF-B (AGTTGAGGGGACTTTCCCAGG; catalog no.…”

Quercetin and epigallocatechin gallate effects on the cell membranes biophysical properties correlate with their antioxidant potential

“…The bioactivity of flavonoids is closely linked to their ability to interact with membranes since many of these compounds generate a cell response even if they are not internalized (Erlejman et al 2008;Verstraeten et al 2008). For example, the location of the polyphenolic structure at the membrane level may result in changes that allow them to sterically hinder the diffusion of free radicals, therefore the interaction with cell membranes might be a decisive factor for their antioxidant activity (Arora et al 2000;Barros et al 2001;Oteiza et al 2005;Sánchez-Gallego et al 2010).…”

Characterisation of phenolic acids, flavonoids, proanthocyanidins and antioxidant activity of water extracts from seed coats of marama bean [Tylosema esculentum] – an underutilised food legume

“…They may also protect by preventing access of deleterious molecules to the hydrophobic region of the bilayer by interacting with membrane phospholipids through hydrogen bonding and accumulate at the membrane surface (Verstraeten et al, 2003). High molecular weight proanthocyanidins in the extract may potentially protect cells such as those lining the gastrointestinal tract against free radical oxidative damage, which is an important factor in gastrointestinal cancers and inflammatory conditions (Erlejman et al, 2008). The extracts at 80 µg ml -1 concentration inhibited TBARS formation in copper-catalyzed human LDL oxidation ( Figure 3B).…”

“…Proanthocyanidins which are major compounds with significant antioxidant activity in extracts from legumes with dark seed coats (Dueñas et al, 2006;Xu et al, 2007a) are not absorbed because of their high molecular weight. However, they are important because they may protect the integrity of the intestinal barrier against oxidative stress, through various mechanisms including antioxidant effect (Erlejman et al, 2008) and they are also thought to play a unique role in sparing other antioxidants in the gastrointestinal tract and thus increasing antioxidant levels in other tissues (Hagerman et al, 1998).…”