TMAO Promotes NLRP3 Inflammasome Activation of Microglia Aggravating Neurological Injury in Ischemic Stroke Through FTO/IGF2BP2

Ge, Pengxin; Duan, Huijie; Tao, Chunrong; Niu, Sensen; Hu, Yiran; Duan, Rui; Shen, Aizong; Sun, Yancai; Sun, Wen

doi:10.2147/jir.s399480

Cited by 7 publications

(6 citation statements)

References 54 publications

(58 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Studies have found that YTHDF1 could enhance the translation of NLRP3 and promote inflammatory responses [ 25 ]. Furthermore, IGF2BP2 negatively feedback regulated the activation of the NLRP3 inflammasome in microglia [ 26 ]. However, the underlying mechanism of m 6 A modification in Hcy-induced cognitive impairment has not been investigated.…”

Section: Introductionmentioning

confidence: 99%

Betaine alleviates cognitive impairment induced by homocysteine through attenuating NLRP3-mediated microglial pyroptosis in an m6A-YTHDF2-dependent manner

Yang,

Huang,

Zhong

et al. 2024

Redox Biology

View full text Add to dashboard Cite

Section: Introductionmentioning

confidence: 99%

Betaine alleviates cognitive impairment induced by homocysteine through attenuating NLRP3-mediated microglial pyroptosis in an m6A-YTHDF2-dependent manner

Yang,

Huang,

Zhong

et al. 2024

Redox Biology

View full text Add to dashboard Cite

“…In order to detect the mRNA expression levels of related inflammatory factors, RT-qPCR was performed according to the description [ 32 ]. The following primers were used: β-actin: forward TGAGCTGCGTTTTACACCCT, reverse GCCTTCACCGTTCCAGTTTT; IL-1β: forward CACCTCTCAAGCAGAGCACAG, reverse GGGTTGCATGGTGAAGTCAAC; IL-6: forward GCTACCAAACTGGATATAATCAGGA, reverse CCAGGTAGCTATGGTACTCCAGAA; TNF-α: forward GACCCTCACACTCAGATCATCTTCT, reverse CCTCCACTTGGTGGTTTGCT.…”

Section: Methodsmentioning

confidence: 99%

Berberine Mediates the Production of Butyrate to Ameliorate Cerebral Ischemia via the Gut Microbiota in Mice

Duan,

Hu,

Deng

et al. 2023

Nutrients

Self Cite

View full text Add to dashboard Cite

Ischemic stroke (IS) is a vascular disease group concomitant with high morbidity and mortality. Berberine is a bioactive substance and it has been known to improve stroke, but its mechanism is yet to be proven. Mice were fed with BBR for 14 days. Then, the mice were made into MCAO/R models. Neurological score, infarct volume, neuronal damage and markers associated with inflammation were detected. We tested the changes in intestinal flora in model mice after BBR administration using 16SrRNA sequencing. Chromatography–mass spectrometry was used to detect butyrate chemically. Tissue immunofluorescence was used to detect the changes in the microglia and astroglia in the mice brains. Our findings suggest that berberine improves stroke outcomes by modulating the gut microbiota. Specifically, after MCAO/R mice were given berberine, the beneficial bacteria producing butyric acid increased significantly, and the mice also had significantly higher levels of butyric acid. The administration of butyric acid and an inhibitor of butyric acid synthesis, heptanoyl-CoA, showed that butyric acid improved the stroke outcomes in the model mice. In addition, butyric acid could inhibit the activation of the microglia and astrocytes in the brains of model mice, thereby inhibiting the generation of pro-inflammatory factors IL-6, IL-1β and TNF-α as well as improving stroke outcomes. Our results suggest that berberine may improve stroke outcomes by modulating the gut flora to increase the abundance of butyric acid. These findings elucidate the mechanisms by which berberine improves stroke outcomes and provide some basis for clinical treatment.

show abstract

“…In order to detect the mRNA expression levels of related inflammatory factors, RT-qPCR was performed according to the description [32]. The following primers were used: β-actin: forward TGAGCTGCGTTTTACACCCT, reverse GCCTTCACCGTTCCAGTTTT; IL-1β: forward CACCTCTCAAGCAGAGCACAG, reverse GGGTTGCATGGTGAAGT-CAAC; IL-6: forward GCTACCAAACTGGATATAATCAGGA, reverse CCAGGTAGC-TATGGTACTCCAGAA; TNF-α: forward GACCCTCACACTCAGATCATCTTCT, reverse CCTCCACTTGGTGGTTTGCT.…”

Section: Real-time Reverse Transcription-quantitative Pcr (Rt-qpcr)mentioning

confidence: 99%

Berberine Mediates the Production of Butyrate to Ameliorate Cerebral Ischemia via Gut Microbiota in Mice

Duan,

Hu,

Deng

et al. 2023

Preprint

View full text Add to dashboard Cite

Ischemic stroke (IS) is a group of vascular disease concomitant with high morbidity and mortality. Berberine is a bioactive substance and it has known to improve stroke, but the mechanism is yet to be proven. Mice were fed with BBR for 14 days. Then, mice were made into MCAO/R models. Neurological score, infarct volume, neuronal damage and markers associated with inflammation were detected. We tested the changes of intestinal flora in model mice after BBR administration by 16SrRNA sequencing. Chromatography-mass spectrometry was used to detect butyrate chemically. Tissue immunofluorescence was used to detect the changes of microglia and astroglia in mice brain. Our findings suggest that berberine improves stroke outcomes by modulating gut microbiota. Specifically, after MCAO/R mice were given berberine, beneficial bacteria producing butyric acid increased significantly, and the mice also had significantly higher levels of butyric acid. Administration of butyric acid and an inhibitor of butyric acid synthesis, heptyl-coA, showed that butyric acid improved stroke outcomes in model mice. In addition, butyric acid could inhibit the activation of microglia and astrocytes in the brain of model mice, thereby inhibiting the release of inflammatory cytokines IL-6, IL-1β, TNF-α and improving stroke outcomes. Our results suggest that berberine may improve stroke outcomes by modulating the gut flora to increase the abundance of butyric acid. These findings elucidate the mechanisms by which berberine improves stroke outcomes and provide some basis for clinical treatment.

show abstract

TMAO Promotes NLRP3 Inflammasome Activation of Microglia Aggravating Neurological Injury in Ischemic Stroke Through FTO/IGF2BP2

Cited by 7 publications

References 54 publications

Betaine alleviates cognitive impairment induced by homocysteine through attenuating NLRP3-mediated microglial pyroptosis in an m6A-YTHDF2-dependent manner

Betaine alleviates cognitive impairment induced by homocysteine through attenuating NLRP3-mediated microglial pyroptosis in an m6A-YTHDF2-dependent manner

Berberine Mediates the Production of Butyrate to Ameliorate Cerebral Ischemia via the Gut Microbiota in Mice

Berberine Mediates the Production of Butyrate to Ameliorate Cerebral Ischemia via Gut Microbiota in Mice

Contact Info

Product

Resources

About