TIP30/CC3 expression in breast carcinoma: relation to metastasis, clinicopathologic parameters, and P53 expression

Zhao, Jian; Ni, Haidong; Ma, Yunchao; Li, Dong; Dai, Jing; Zhao, Feng; Yan, Xiaoyan; Lü, Bin; Xu, Hao; Guo, Yajun

doi:10.1016/j.humpath.2006.08.005

Cited by 44 publications

(46 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The stably transfected cell clones were obtained by limiting dilution and confirmed by Western blot analysis using anti-p53 antibody (DO-1, Santa Cruz Biotechnology). HuR4 small interfering RNA (siRNA) AACACGCUGAACGGCUUGAGG (16), Tip30 siRNA CCGGCA-GAGUGCUCUUAAA (21), and control siRNA AAGUAGCUUGGCCUUGA were transfected with Lipofectamine 2000 (Invitrogen).…”

Section: Methodsmentioning

confidence: 99%

TIP30 Induces Apoptosis under Oxidative Stress through Stabilization of p53 Messenger RNA in Human Hepatocellular Carcinoma

et al. 2008

Self Cite

View full text Add to dashboard Cite

Reactive oxygen species (ROS) and cellular oxidant stress have long been associated with cancer. Here, we show that TIP30, also called CC3, regulates p53 mRNA stability and induces apoptosis by sensing of intracellular oxidative stress in human hepatocellular carcinoma (HCC) cells. Introduction of TIP30 induced more cell death in HepG2 cells with a high level of intracellular ROS than that in normal liver cell line, HL7702, which had low level of intracellular ROS. Treatment with an antioxidant agent attenuated TIP30-induced cell death in HepG2 cells, whereas oxidant H 2 O 2 augmented TIP30-induced cell death in HL7702 cells. The conformation of TIP30 was altered with the formation of an intermolecular disulfide bridge under oxidative stress. TIP30 greatly enhanced p53 expression and its transcriptional activity under oxidative stress, which was probably through stabilization of p53 mRNA. TIP30 induced apoptosis and mitochondrial dysfunction were blocked by silencing of p53 expression. The nuclear import of mRNA-binding protein HuR was blocked upon TIP30 introduction, which might be due to the interruption of the association of HuR with importin B2. The elevated cytoplasmic HuR bound to p53 mRNA 3 ¶-untranslated region, resulting in prolonged half-life of p53 mRNA. Our results suggest that TIP30 is involved in cellular oxidative stress surveillance and induces apoptosis through stabilization of p53 mRNA in HCC cells. [Cancer Res 2008;68(11):4133-41]

show abstract

Section: Methodsmentioning

confidence: 99%

TIP30 Induces Apoptosis under Oxidative Stress through Stabilization of p53 Messenger RNA in Human Hepatocellular Carcinoma

et al. 2008

Self Cite

View full text Add to dashboard Cite

show abstract

“…Fifty-nine HCC tissues used in this study were obtained from Eastern Hepatobiliary Surgical Hospital and Guangxi Cancer Hospital (Nanning) with the informed consent. The expressions of TIP30 protein in the specimens were detected by immunohistochemistry assay with polyclonal antibody against human TIP30 as described previously (19). TIP30 expression was then evaluated.…”

Section: Methodsmentioning

confidence: 99%

Methylation of Tip30 Promoter Is Associated with Poor Prognosis in Human Hepatocellular Carcinoma

Lü

et al. 2008

Clinical Cancer Research

Self Cite

View full text Add to dashboard Cite

Purpose: To investigate Tip30 promoter methylation status in human hepatocellular carcinoma (HCC) and the correlation with clinicopathologic features and prognosis. Experimental Design: The methylation status of CpG islands inTip30 promoter was examined in 15 HCC cell lines as well as 59 paired HCC and adjacent nontumor tissues. The associations betweenTip30 methylation status and the survival of patients were analyzed. Results: Tip30 promoter was hypermethylated in 6 of 10 HCC cell lines with reduced Tip30 mRNA. DNA methyltransferase inhibitor, 5-aza-2 ¶-deoxycytidine, greatly enhanced TIP30 expression and sensitized HCC cells to cytotoxic drug-induced cell death. The promoter region of Tip30 was identified and the main promoter activity was located in the -135 to -45 region sited within a CpG island. The minimal promoter element contained four Sp1binding sites, which were hypermethylated in HCC cell-derived promoters. Moreover, analyses of Tip30 promoter methylation status in 59 paired HCC tissues showed that 47% of the cases were hypermethylated. Recurrence rate (95% versus 67%; P = 0.011) and mortality (82% versus 53%; P = 0.033) were significantly higher in patients with methylated Tip30. Disease-free survival was significantly higher in patients with unmethylated Tip30 (33.3% versus 4.5%; P = 0.036). Conclusions: Our results show that epigenetic silencing ofTip30 gene expression by CpG island DNA hypermethylation is associated with poor prognosis in patients with HCC.

show abstract

“…Defects in TIP30 are associated with metastasis of small cell lung carcinoma (42) and breast carcinoma (43) or with carcinogenesis of hepatocellular carcinoma (44). The baseline expression of TIP30 varies from organ to organ and is relatively low in brains and neural-derived cell lines (42).…”

Section: Demyelinated Axons In Ms Expressmentioning

confidence: 99%

Abnormal expression of TIP30 and arrested nucleocytoplasmic transport within oligodendrocyte precursor cells in multiple sclerosis

et al. 2008

View full text Add to dashboard Cite

Oligodendrocyte precursor cells (OPCs) persist near the demyelinated axons arising in MS but inefficiently differentiate into oligodendrocytes and remyelinate these axons. The pathogenesis of differentiation failure remains elusive. We initially hypothesized that injured axons fail to present Contactin, a positive ligand for the oligodendroglial Notch1 receptor to induce myelination, and thus tracked axoglial Contactin/Notch1 signaling in situ, using immunohistochemistry in brain tissue from MS patients containing chronic demyelinated lesions. Instead, we found that Contactin was saturated on demyelinated axons, Notch1-positive OPCs accumulated in Contactin-positive lesions, and the receptor was engaged, as demonstrated by cleavage to Notch1-intracellular domain (NICD). However, nuclear translocalization of NICD, required for myelinogenesis, was virtually absent in these cells. NICD and related proteins carrying nuclear localization signals were associated with the nuclear transporter Importin but were trapped in the cytoplasm. Abnormal expression of TIP30, a direct inhibitor of Importin, was observed in these OPCs. Overexpression of TIP30 in a rat OPC cell line resulted in cytoplasmic entrapment of NICD and arrest of differentiation upon stimulation with ContactinFc. Our results suggest that extracellular inhibitory factors as well as an intrinsic nucleocytoplasmic transport blockade within OPCs may be involved in the pathogenesis of remyelination failure in MS.

show abstract

TIP30/CC3 expression in breast carcinoma: relation to metastasis, clinicopathologic parameters, and P53 expression

Cited by 44 publications

References 21 publications

TIP30 Induces Apoptosis under Oxidative Stress through Stabilization of p53 Messenger RNA in Human Hepatocellular Carcinoma

TIP30 Induces Apoptosis under Oxidative Stress through Stabilization of p53 Messenger RNA in Human Hepatocellular Carcinoma

Methylation of Tip30 Promoter Is Associated with Poor Prognosis in Human Hepatocellular Carcinoma

Abnormal expression of TIP30 and arrested nucleocytoplasmic transport within oligodendrocyte precursor cells in multiple sclerosis

Contact Info

Product

Resources

About