Time course differential gene expression in response to porcine circovirus type 2 subclinical infection

Abstract

This study was aimed at characterizing the potential differences in gene expression in piglets inoculated with Porcine circovirus type 2 (PCV2), the essential causative agent of postweaning multisystemic wasting syndrome. Seven-day-old caesarean-derived, colostrum-deprived piglets were distributed into two groups: control (n = 8) and pigs inoculated with 105.2 TCID50 of the Burgos PCV2 isolate (n = 16). One control and three inoculated pigs were necropsied on days 1, 2, 5, and 8 post-infection (p.i.). The remaining pigs (four of each group) were sequentially bled on days 0, 7, 14, 21, and 29 p.i. (necropsy). Total RNA from the mediastinal lymph node (MLN) and lysed whole blood (LWB) samples were hybridized to Affymetrix Porcine GeneChip®. Forty-three probes were differentially expressed (DE) in MLN samples (FDR < 0.1, fold change > 2) and were distributed into three clusters: globally down-regulated genes, and up-regulated genes at early (first week p.i.) and late (day 29 p.i.) stages of infection. In LWB samples, maximal differences were observed at day 7 p.i., with 54 probes DE between control and inoculated pigs. Main Gene Ontology biological processes assigned to up-regulated genes were related to the immune response. Six common genes were found in both types of samples, all of which belonged to the interferon signaling antiviral effector pathway. Down-regulated genes were mainly related to cell adhesion and migration in MLN, and cellular organization and biogenesis in LWB. Microarray results were validated by quantitative real-time PCR. This study provides, for the first time, the characterization of the early and late molecular events taking place in response to a subclinical PCV2 infection.

Transcriptomic Response of Porcine PBMCs to Vaccination with Tetanus Toxoid as a Model Antigen

“…Consistent with our findings are earlier results for the pig [17], [29] and studies of murine spleen lumphocyctes [25], [28] that found differential expression of genes involved in both immune response and processes of cell signaling, cellular and organismal growth, cell cycle control, apoptosis, cytoskeleton organization, biosynthesis, metabolism as well as stress, toxicology response and oncogenesis or tumor suppression.…”

Transcription analysis of the porcine alveolar macrophage response to porcine circovirus type 2

“…For example, the same phenomenon was observed upon macrophage exposure to tobacco smoke, wherein the expression of TLR3 was increased and severe inflammation was observed after treated with TLR3 ligand [32]. Reverse: AAACGGCAAACACCATCCAAAGT a from reference [21], b from reference [22], c from reference [9].…”

“…Previous studies have investigated the cytokine and chemokine gene expression profile of PMWS by transcriptomic and genomic analyses. For example, the cytokine mRNA expression profile in lymph nodes of PMWS pigs was reported [17], as was the global transcriptome profile of colostrums-deprived piglets experimentally infected with PCV2 [18,19]. The genomic expression profile in lymph nodes of lymphoid-depleted PCV2-infected pigs was also reported [20].…”

PorSignDB: a database of in vivo perturbation signatures for dissecting clinical outcome of PCV2 infection

“…Intriguingly, the second deviating gene signature originates from pigs that were subclinically infected with PCV2 (Fig 2A, arrow). Unlike S. Typhimurium , this cannot be explained by pathogen clearance since these experimentally PCV2-infected pigs remained viremic throughout the original study [19]. Instead, pathogen-distressed host responses appear here to be repressed in lymph nodes with low-level subclinical PCV2 replication.…”