TIM4-TIM1 interaction modulates Th2 pattern inflammation through enhancing SIRT1 expression

Hu, Tian‐Yong; Fan, Xiaoqin; Ma, Li; Liu, Jiang‐Qi; Chang, Yunli; Yang, Ping‐Chang; Qiu, Shuqi; Chen, Tao; Yang, Litao; Liu, Zhiqiang

doi:10.3892/ijmm.2017.3150

Cited by 18 publications

(10 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…RNA was reverse‐transcribed into cDNA using PrimeScript First Strand cDNA Synthesis Kit (Takara, Dalian, China) according to the manufacturer's protocol, and the complementary DNA was then subjected to qPCR on the MiniOpticon™ Real‐Time PCR System (Bio‐Rad, CA, USA). The primers used in the experiments were as follows: sirt1: forward, ctgttgaccgatggactcct and reverse, gccacagcgtcatatcatcc; β‐actin: forward, gtgggaatgggtcagaagga and reverse, tcatcttttcacggttggcc were the same as described previously . The amplification protocol was performed as follows: 1 cycle at 98°C for 1 minutes, followed by 40 cycles at 98°C for 10 seconds, 56°C for 20 seconds and 72°C for 30 seconds.…”

Section: Methodsmentioning

confidence: 99%

SIRT1 attenuates murine allergic rhinitis by downregulated HMGB 1/TLR4 pathway

et al. 2018

View full text Add to dashboard Cite

Conventional allergic rhinitis (AR) treatments have limitations due to the lack of safety and complete cure strategy. We evaluated the effects of silent information regulator 1 (SIRT1), a multifunctional molecule involved in a variety of inflammatory pathways, on murine AR model. Ovalbumin (OVA)-induced murine model was constructed, and recombinant SIRT1 was administered into the nostril continuously. The expression of SIRT1 was measured at mRNA and protein levels, and the allergic symptoms were evaluated. Protein levels of OVA-specific IgE, leukotriene C4 (LTC4), eosinophil cation protein (ECP), prostaglandin D2 (PGD2), as well as different inflammatory cytokine mediators in the serum and nasal lavage fluid (NLF), were assessed by ELISA. The effects of SIRT1 on human primary nasal epithelial cells challenged with tumour necrosis factor (TNF)-α were also evaluated by investigating the HMGB1/TLR4 signalling pathway. Administration of SIRT1 significantly alleviated OVA-induced AR symptoms with lower numbers of sneezing and nasal rubbing events, decreased levels of OVA-specific IgE, LTC4, ECP, PGD2, less inflammatory cells and downregulated levels of Th2 type cytokines. SIRT1 also reduced the genes of HMGB1/TLR4 signalling pathway in the murine model and cultured human nasal epithelial cells. Expression of SIRT1 is impaired in OVA-induced AR model. The administration of SIRT1 alleviates the allergic symptoms of mice, regulates the production of pro-inflammatory mediators predominantly produced by Th2 cells in AR and attenuates expressions of proteins relevant to HMGB1/TLR4 signalling pathway. All the results showed that SIRT1 is promising as a therapeutic agent of AR.

show abstract

Section: Methodsmentioning

confidence: 99%

SIRT1 attenuates murine allergic rhinitis by downregulated HMGB 1/TLR4 pathway

et al. 2018

View full text Add to dashboard Cite

show abstract

“…During allergic rhinitis inflammation, SIRT1 expression by CD4 + T cells was enhanced after interaction of TIM4 and TIM1 through promoting PI3K/Akt phosphorylation. Moreover, SIRT1 promoted the proliferation of Th2 CD4 + T cells via inhibiting Fas ligand and caspase-3 expression [28]. We found that SIRT1expression levels in nasal mucosa significantly decreased after allergic rhinitis induction in WT mice, while the SIRT1 level was much higher in HIF1a CD11c–/– mice with allergic rhinitis than in WT-AR mice.…”

Section: Discussionmentioning

confidence: 96%

HIF1α Deficiency in Dendritic Cells Attenuates Symptoms and Inflammatory Indicators of Allergic Rhinitis in a SIRT1-Dependent Manner

Niu

Wang

et al. 2020

Int Arch Allergy Immunol

View full text Add to dashboard Cite

Background: Allergic rhinitis is the most prevalent atopic disorder worldwide. Inflammation is believed to participate in allergic rhinitis. Previous studies indicate that hypoxia-inducible factor (HIF) promotes the development of allergic rhinitis, and dendritic cells are also involved in allergic rhinitis. Methods: We explored the consequences of HIF1α deficiency in dendritic cells on allergic rhinitis. Allergic rhinitis in mice was induced by ovalbumin (OVA). The levels of IgE, leukotriene C4 (LTC4), eosinophil cationic protein (ECP), prostaglandin D2 (PGD2), IFN-γ, IL-2, IL-4, IL-5, IL-10, and IL-13 in serum or nasal lavage fluid (NLF) were detected by ELISA. Inflammatory cells in NLF were counted by hemocytometer. The protein levels of p-ERK1/2, p-p38, p-JNK2, SIRT1, p-IκBα, and p65 were determined by Western blot. Results: HIF1α deficiency in dendritic cells (HIF1α CD11c-/-) decreased sneezing and nasal rubbing, the production of OVA-specific IgE, LTC4, and ECP in serum and NLF, and the numbers of leukocytes, eosinophils, lymphocytes, and neutrophils in NLF. Th1 cytokines increased, while Th2 cytokines decreased in HIF1a CD11c-/mice. SIRT1/NF-κB signaling was inhibited in HIF1α CD11c-/mice, while SIRT1 inhibitor administration in HIF1α CD11c-/mice attenuated the symptoms and inflammatory indicators of allergic rhinitis. Conclusion: HIF1α deficiency in dendritic cells attenuates symptoms and inflammatory indicators of allergic rhinitis in a SIRT1-dependent manner.

show abstract

“…TIMD4 is a phosphatidylserine receptor that enhances the engulfment of apoptotic cells, a primary role of macrophages in response to tissue injury. Activation of TIMD4 promotes Th1 cell apoptosis and Th2 cell proliferation (16,17), and has a prominent role in autoimmune diseases including rheumatoid arthritis and systemic lupus erythematosus (18).…”

Section: Discussionmentioning

confidence: 99%

Transcriptome analysis of the NR1H3 mouse model of multiple sclerosis reveals a pro-inflammatory phenotype with dysregulation of lipid metabolism and immune response genes

Vilariño‐Güell

Encarnacion

et al. 2021

Preprint

View full text Add to dashboard Cite

BackgroundThe development of effective treatments for multiple sclerosis (MS), and in particular its progressive forms, is hampered by the lack of etiologically relevant cellular and animal models of human disease. Models that recapitulate the biological and pathological processes leading to the onset and progression of MS in patients are likely to afford better translational efficacy. Following the discovery of the NR1H3 p.Arg415Gln pathogenic mutation for progressive MS in two Canadian families, we developed a knock-in mouse model harboring a homologous mutation in the endogenous gene to provide a more physiologically relevant model of human MS.MethodsGene expression was evaluated in constitutive heterozygote (which recapitulates the human disease genotype) and homozygote Nr1h3 p.Arg413Gln knock-in mice on a C57BL/6 background, and compared to wild-type littermates. AmpliSeq Transcriptome Mouse Gene Expression kits analyzed on an Ion Proton sequencer were used to generate the gene expression profiles of spleen, liver, brain and spinal cord tissue from three-month-old male and female mice. Differential expression between genotypes was assessed with DESeq2, and Gene Ontologies pathways enrichment analysis performed with DAVID v6.8. Benjamini-Hochberg false discovery rate (FDR) correction for multiple testing was applied.ResultsTranscriptome analysis of spleen tissue from Nr1h3 p.Arg413Gln mice revealed 23 significantly dysregulated genes (FDR<0.05) with greater than a two-fold change in expression. These include CD5 antigen-like (Cd5l), complement component 6 (C6), procollagen C-endopeptidase enhancer 2 (Pcolce2), interleukin 22 receptor, alpha 2 (Il22ra2), and T cell immunoglobulin and mucin domain containing 4 (Timd4). Gene Ontology enrichment analysis support upregulation of cell cycle pathways and downregulation of immune system response in splenic cells. The liver transcriptome identified 27 significantly dysregulated genes with greater than a two-fold change in expression compared to wild-type littermates. Cd5l, Timd4, C-C motif chemokine receptor 3 (Ccr3), ADAM metallopeptidase domain 11 (Adam11) and macrophage expressed 1 (Mpeg1) were amongst those most significantly dysregulated. Enrichment analysis supported altered immune function with upregulation of sterol and steroid metabolic processes and downregulation of fatty acid biosynthesis and inflammatory and immune system responses. Although brain and spinal cord transcriptome profiles identified several genes significantly dysregulated in Nr1h3 mice compared to wild-type littermates (FDR<0.05), none presented greater than two-fold changes in gene expression.DiscussionThe analysis of the Nr1h3 p.Arg413Gln mouse model of MS suggests that the predominance of a pro-inflammatory over a healing or reparative phenotype, combined with deficiencies in myelination and remyelination, are the biological mechanisms implicated in the onset of MS and the development of a more severe progressive disease course observed in patients with NR1H3 mutations. Association of NR1H3 common variants with MS risk indicates that the disruption of these biological and immunological processes is not only informative for familial forms of disease but MS patients at large. Differences in transcriptome profiles underline the value of this model for the development and validation of novel therapeutic strategies and ultimately treatments with the potential to delay or even halt the onset of progressive MS and to ameliorate the severity of clinical symptoms.

show abstract

TIM4-TIM1 interaction modulates Th2 pattern inflammation through enhancing SIRT1 expression

Cited by 18 publications

References 31 publications

SIRT1 attenuates murine allergic rhinitis by downregulated HMGB 1/TLR4 pathway

SIRT1 attenuates murine allergic rhinitis by downregulated HMGB 1/TLR4 pathway

HIF1α Deficiency in Dendritic Cells Attenuates Symptoms and Inflammatory Indicators of Allergic Rhinitis in a SIRT1-Dependent Manner

Transcriptome analysis of the NR1H3 mouse model of multiple sclerosis reveals a pro-inflammatory phenotype with dysregulation of lipid metabolism and immune response genes

Contact Info

Product

Resources

About