Thymoquinone, piperine, and sorafenib combinations attenuate liver and breast cancers progression: epigenetic and molecular docking approaches

Abstract

Background Traditional herbal medicine has been used for centuries to cure many pathological disorders, including cancer. Thymoquinone (TQ) and piperine (PIP) are major bioactive constituents of the black seed (Nigella sativa) and black pepper (Piper nigrum), respectively. The current study aimed to explore the potential chemo-modulatory effects, mechanisms of action, molecular targets, and binding interactions after TQ and PIP treatments and their combination with sorafenib (SOR) against human triple-negative breast cancer (MDA-MB-231) and liver cancer (HepG2) cells. Methods We determined drug cytotoxicity by MTT assay, cell cycle, and death mechanism by flow cytometry. Besides, the potential effect of TQ, PIP, and SOR treatment on genome methylation and acetylation by determination of DNA methyltransferase (DNMT3B), histone deacetylase (HDAC3) and miRNA-29c expression levels. Finally, a molecular docking study was performed to propose potential mechanisms of action and binding affinity of TQ, PIP, and SOR with DNMT3B and HDAC3. Results Collectively, our data show that combinations of TQ and/or PIP with SOR have significantly enhanced the SOR anti-proliferative and cytotoxic effects depending on the dose and cell line by enhancing G2/M phase arrest, inducing apoptosis, downregulation of DNMT3B and HDAC3 expression and upregulation of the tumor suppressor, miRNA-29c. Finally, the molecular docking study has identified strong interactions between SOR, PIP, and TQ with DNMT3B and HDAC3, inhibiting their normal oncogenic activities and leading to growth arrest and cell death. Conclusion This study reported TQ and PIP as enhancers of the antiproliferative and cytotoxic effects of SOR and addressed the mechanisms, and identified molecular targets involved in their action.

Sorafenib and Piperine co-loaded PLGA nanoparticles: Development, characterization, and anti-cancer activity against hepatocellular carcinoma cell line

“…El-Shehawy et al conducted a study employing a therapeutic combination strategy, in which Thymoquinone and PIP were combined with SORA for the treatment of liver and breast malignancies. In vitro studies, including MTT assay, revealed that the combination therapeutic approach was more cytotoxic compared to each single treatment ( El-Shehawy et al, 2023 ). However, the lipophilic drugs were dissolved in human incompatible solvents, unlike in this present study, where a translatable, biocompatible FDA-approved vehicle (PLGA) was used.…”

Formulation of silymarin surface modified vesicles: In vitro characterization to cell viability assessment

“…Therefore, to accomplish docking study of drug & carriers (considered as ligands) against the vascular endothelial growth factor receptor-2 (VEGFR-2), the target site having PDB ID: 3V2A was downloaded from RCSB PDB database ( http://www.rcsb.org ). As per the prior studies ( El-Shehawy et al, 2023 ) chain A was selected. For the refinement and preparation process, the energy was minimized for the downloaded macromolecule by using the AutoDock Tools version 1.5.6.…”

Ropivacaine combined with sorafenib attenuates hepatocellular carcinoma cell proliferation and metastasis by inhibiting the miR‐224/HOXD10 axis

“…The concentration range of Rop and Sor is based on previous study. 7,14,15 To study whether they have combined therapeutic effect on HCC, we selected the smallest concentration. miR-224 mimic (TCAAGTCACTAGTGGTTCCGTTTAG), NC mimic (TCACAACCTCCTAGAAAGAGTAGA), miR-224 inhibitor (CTAAACG GAACCACTAGTGACTTGA), NC inhibitor (TCTACTCTTTCTAG GAGGTTGTGA), siRNA against Homeobox D10 (si-HOXD10, CTGCAAAGAGTGGCAGAAAGAAG), and si-NC (TTCTCCGAACGT GTCACGTTT) were obtained from Shanghai GenePharma.…”