Thymidine kinase in epithelial ovarian cancer: Relationship with the other pyrimidine pathway enzymes

Abstract

TK is a pyrimidine metabolic pathway enzyme involved in salvage DNA synthesis. What roles TK may play in epithelial ovarian cancer and the relationships between TK and the other pyrimidine pathway enzymes remain unclear. We examined TK1 gene expression by RT-PCR and related it to gene expression of TS, TP and DPD in 69 samples from epithelial ovarian cancer, 8 low-malignant-potential tumors, 16 benign ovarian tumors and 34 normal ovaries. Additionally, cytosolic and serum TK activities were determined by radioenzymatic assay. TK1 gene expression, the ratio of TK1 to TS gene expression, that of TK1 to TP and that of TK1 to DPD were significantly higher in epithelial ovarian cancer than in normal ovaries. In epithelial ovarian cancer, TK1 gene expression correlated with cytosolic and serum TK activities, Key words: thymidine kinase; thymidylate synthase; thymidine phosphorylase; dihydropyrimidine dehydrogenase; epithelial ovarian cancer; radioenzymatic assay; capecitabine TK is an important pyrimidine metabolic pathway enzyme, which catalyzes the phosphorylation of thymidine to deoxythymidine monophosphate using either exogenous or endogenous metabolic thymidine as a substrate. 1 This salvage pathway is the only one by which thymidine is introduced into DNA synthesis. Two isoforms of the TK gene (TK1 and TK2) have been described. 2,3 In addition, a modification of the sequence for TK1 has been described. 4 TK1, which is located in the cytoplasm, is a cell cycleregulated enzyme. 5 Its activity fluctuates with DNA synthesis, being high in dividing and malignant cells and low in quiescent cells. 6,7 TK2 is considered to be located in the mitochondria; levels of TK2 remain relatively constant throughout the cell cycle. Clinical studies have reported elevated serum TK activity in various human malignancies. 8 The majority of these studies concerned hematologic malignancies, but serum TK activity was also elevated in patients with epithelial ovarian cancer. 9 Additionally, serum and cytosolic TK activities appear to have prognostic value in some solid tumors, such as breast, 7,10,11 small cell lung, 12 prostate 13 and cervical 14 cancers. However, little is known about the clinical and prognostic value of tissue TK gene expression in human cancers.TS, TP, DPD and TK are pyrimidine pathway enzymes for de novo DNA synthesis or salvage nucleotide synthesis. TS is an enzyme for the de novo synthesis of deoxythymidine monophosphate (the same product as TK) and is associated with cell proliferative activity. 15,16 TP catalyzes the reversible phosphorolysis of thymidine (the same substrate as TK) to thymine and 2-deoxy-Dribose-1 phosphate 17 and has angiogenic and antiapoptotic effects. 18,19 Subsequently, thymine is degraded to dihydrothymine by DPD, which is inversely related to malignant behavior. 20,21 These 3 enzymes are also responsible for the efficacy and metabolism of fluoropyrimidine cytostatic agents. TS is a critical target enzyme of these drugs. 15 The new agent capecitabine (N 4 -pentyloxycarbonyl-5Ј-deoxy-5-fluo...

Sensitive Nonradiometric Method for Determining Thymidine Kinase 1 Activity

“…In another recent study with 1692 patients with primary breast cancer, high TK values were shown to be an important risk factor in node-negative patients and seemed to be associated with beneficial effect of adjuvant chemotherapy (21,22 ). The development of specific inhibitors of human TK1 activity to be used in combination with inhibitors of de novo pyrimidine synthesis is a major challenge to improve the efficiency of chemotherapy (49 ). Measurement of TK1 activity could be a critical issue in this area.…”

Impaired adrenocorticotropic hormone response to bacterial endotoxin in mice deficient in prostaglandin E receptor EP1 and EP3 subtypes

“…The hypothalamus was isolated as defined (25) and homogenized within 3 min after decapitation. Total RNA was extracted by using TRIzol solution (Invitrogen) and subjected to semiquantitative RT-PCR by using Light-Cycler (Roche Diagnostics) as described (26). Primers and fluorescent probes for mouse c-fos and GAPDH mRNA were obtained from Nihon Gene Research Laboratories (Sendai, Japan).…”

Dihydropyrimidine dehydrogenase in normal and malignant endometrium: relationship with cell proliferation and thymidine phosphorylase

“…The hybridization probes were fluoresce in probe 5 0 CAGTAAAGCAGGAATGTGCGCCT 3 0 -fluorescein and LC Red640 probe, LC Red640-5 0 TCACTCTCCATTGCCATC-GATACG 3 0 -phosphorylation. Real-time PCR methods for glyceraldehyde-3-phosphate dehydrogenase (GenBank accession number M33197; GAPDH) have been previously described [9].…”

“…In order to determine the accuracy of our conventional RT-PCR methods, DPD gene expression was determined by a real-time quantitative RT-PCR method previously described in 11 tissue specimens [9]. Real-time quantitative PCR was performed by hybridization probe format LightCycler system.…”