THRA and DIO2 mutations are unlikely to be a common cause of increased bone mineral density in euthyroid post-menopausal women

Abstract

Objective: A new autosomal dominant disorder due to mutation of THRA, which encodes thyroid hormone receptor a, is characterised by severely delayed skeletal development but only slightly abnormal thyroid status. Adult mice with disrupted thyroid hormone action in bone due to a mutation of Thra or deletion of Dio2, encoding the type 2 deiodinase, have high bone mass and mineralisation despite essentially euthyroid status. No individuals with DIO2 mutations have been described and the adult phenotype of patients with THRA mutations is largely unknown. We hypothesised that screening euthyroid adults with high bone mineral density (BMD) could be used to identify individuals with mutations of THRA or DIO2. Design: The Osteoporosis and Ultrasound Study (OPUS) is a 6-year prospective study of fracture-related factors from five European centres. Methods: A cohort of 100 healthy euthyroid post-menopausal women with the highest BMD was selected from the OPUS population. We sequenced the intron-exon boundaries and critical exons of THRA and DIO2 in these subjects. TSH, free 3,5,3 0 -L-triiodothyronine, free thyroxine, vitamin D, parathyroid hormone and bone turnover marker concentrations, and BMD measurements were available in all OPUS participants. Results: No coding sequence or splice site mutations affecting THRA or DIO2 were identified. Conclusions: Mutations affecting THRA or DIO2 are not a common cause of high BMD in healthy euthyroid post-menopausal women.European Journal of Endocrinology (2014) 170, 637-644 IntroductionThyroid hormones (thyroxine (T 4 ) and 3,5,3 0 -L-triiodothyronine (T 3 )) are essential for skeletal development, post-natal growth, and bone maturation. In adults, thyroid hormones regulate bone turnover, and normal euthyroid status is required to maintain optimal bone mass and mineralisation (1). Accordingly, thyrotoxicosis is a well-established cause of osteoporosis, and hypothyroidism is associated with an increased risk of fracture (2).The thyroid gland secretes T 4 and T 3 in a ratio of about 15:1, but T 4 is a pro-hormone and must be converted to T 3 in the peripheral tissues (3). Conversion of T 4 to T 3 in target cells is catalysed by type 2 iodothyronine deiodinase (DIO2), and the activity of this enzyme regulates intracellular availability of T 3 . Two nuclear receptors, TRa and TRb, mediate T 3 action in the target cells, and their relative levels of expression vary between tissues. European Journal of Endocrinology Clinical StudyA Gogakos and others THRA and DIO2 in women with high bone density For example, TRa is expressed at high levels in bone and cartilage, whereas TRb predominates in the hypothalamus and pituitary, where it mediates feedback control of the hypothalamic-pituitary-thyroid (HPT) axis (4). The syndrome of resistance to thyroid hormone (RTH) was described in 1967 (5) and the first THRB mutations affecting TRb were identified in 1989 (6). Heterozygous mutations of THRA were finally reported in three families in 2012 and 2013 (7, 8, 9, 10). Affected individuals a...

Thyrostimulin Regulates Osteoblastic Bone Formation During Early Skeletal Development

“…Full-length Gpa2 and Gpb5 cDNAs were amplified from total mouse brain RNA by RT-PCR using primers mGPA2F, GACTGTCCTTTGCAGATGCCC and murine GPA2R, AGCCCCGAG TTTGAGATACCC for Gpa2 and primers mGPB5F, AGCCTGGGGTACAAGTGTCAGC and mGPB5R, TGGAGCCAGTGGATGTGTGAG for Gpb5 . The Gpa2 and Gpb5 cDNAs were subcloned into pGEM-T Easy (Promega) and sequenced ( 36 ). GPA2 and GPB5 subunits were either coexpressed or expressed individually using the bicistronic vector pBudCE4.1 (Invitrogen): 1) Gpa2 was subcloned into the pBudCE4.1 using the Not I and Xho I sites resulting in expression of a His-V5-tagged GPA2 protein (GPA2-His-V5), 2) Gpb5 was subcloned into pBudCE4.1 using the Hin dIII and Bam HI sites resulting in expression of a hemagglutinin (HA)-tagged GPB5 protein (GPB5-HA), and 3) both Gpa2 and Gpb5 were subcloned into pBudCE4.1 (GPA2-His-V5+GPB5-HA).…”

Genetic abnormalities in thyroid hormone deiodinases

“…It should be highlighted that large collaborative studies even in selected populations at potentially higher risk of genetic mutations are required. For instance, a study of 100 individuals with high bone mass found no evidence of TRa or DIO1 mutations [36]. A large meta-analysis of genetic variants associated with thyroid function is currently underway and results are expected in the near future.…”

Thyroid-stimulating hormone decreases the risk of osteoporosis by regulating osteoblast proliferation and differentiation

“…In addition to these in vivo experiments, studies have reported associations between higher than normal levels of free T3 and free T4 with reduced bone density and an increased risk of non-vertebral fractures. High free T4 and free T3 levels are associated with low bone density in the hip joint, while high free T4 levels are also associated with potential bone loss at the hip joint [16]. However, thyroid hormone has been shown to stimulate cells to secrete insulin-like growth factor I that further stimulates osteoblast progenitor cells and nally promotes the differentiation and proliferation of osteoblasts.…”