Thermostable negative-marker foot-and-mouth disease virus serotype O induces protective immunity in guinea pigs

Abstract

Foot-and-mouth disease (FMD) is a contagious viral disease of high economic importance, caused by FMD virus (FMDV), a positive-sense single-stranded RNA virus, affecting cloven-hoofed animals. Preventive vaccination using inactivated virus is in practice to control the disease in many endemic countries. While the vaccination induces antibodies mainly to structural proteins, the presence of antibodies to the non-structural proteins (NSP) is suggestive of infection, a criterion for differentiation of infected from vaccinated animals (DIVA). Also, there is a growing demand for enhancing the stability of the FMD vaccine virus capsid antigen as the strength of the immune response is proportional to the amount of intact 146S particles in the vaccine. Considering the need for a DIVA compliant stable vaccine, here we report generation and rescue of a thermostable and negative marker virus FMDV serotype O (IND/R2/1975) containing a partial deletion in non-structural protein 3A, generated by reverse genetics approach. Immunization of guinea pigs with the inactivated thermostable-negative marker virus antigen induced 91% protective immune response. Additionally, a companion competitive ELISA (cELISA) targeting the deleted 3A region was developed, which showed 92.3% sensitivity and 97% specificity, at cut-off value of 36% percent inhibition. The novel thermostable-negative marker FMDV serotype O vaccine strain and the companion cELISA could be useful in FMDV serotype O enzootic countries to benefit the FMD control program. Key points • Thermostable foot-and-mouth disease virus serotype O with partial deletion in 3A . • Inactivated thermostable marker vaccine induced 91% protection in guinea pigs . • Companion cELISA based on deleted region in 3A could potentially facilitate DIVA . Supplementary information The online version contains supplementary material available at 10.1007/s00253-023-12359-w.

Designing one-step reverse transcriptase loop-mediated isothermal amplification for serotype O foot-and-mouth disease virus detection during the 2022 outbreak in East Java, Indonesia

“…Reverse transcriptase loop-mediated isothermal amplification products from samples of the 2022 East Java FMD outbreak, gathered from foot vesicles (5/5), nasal secretion (5/5), and saliva (4/4), led to successful identification of serotype O FMDV in all instances. The outcomes were subsequently verified using the established gold standard FMDV detection method, RT-PCR, with recognized primers for serotype O FMDV [ 25 ]. Reverse transcriptase polymerase chain reaction also identified serotype O FMDV in every sample.…”

“…Following the reverse transcriptase procedure, amplification was conducted with a 12.5 μL mix consisting of 2× PCR Master mix Solution ( i -Taq) ( iNtRon, Gyeonggi-do, Republic of Korea), 1 μL of primer forward DHP13 (10 nmol; GTGACTGAACTGCTTTACCGCAT), 1 μL of primer reverse NK61 (10 nmol; GACATGTCCTCCTGCATCTG), 2.5 μL of nuclease-free water, and 3 μL of cDNA sample. The PCR reaction was performed using a Bioer Thermal cycler (Bioer Technology, Hangzhou, Japan) with the following temperature cycle: initial denaturation at 96°C for 30 s; 40 cycles of denaturation at 94°C for 15 s, annealing at 60°C for 30 s, and extension at 68°C for 30 s; and a final extension cycle at 68°C for 3 min [ 25 , 26 ]. Electrophoresis of PCR results was performed on 2% agarose gel with TBE1×(Promega) and RedSafe ( i NtRon, Gyeonggi-do, Republic of Korea) agarose gel dye.…”

“…The PCR product from one sample (JT-INDO-K3) was forwarded to the Apical Scientific Laboratory (PT. Genetics Science Indonesia) with DHP13 primers [ 25 , 26 ]. Analysis of the constructed phylogenetic tree was achieved using detected FMDV data through BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi), along with references to whole genomes of FMDV serotype O isolates from GenBank.…”