Therapeutic rAAVrh10 MediatedSOD1Silencing in AdultSOD1^G93AMice and Nonhuman Primates

Abstract

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease; survival in ALS is typically 3–5 years. No treatment extends patient survival by more than three months. Approximately 20% of familial ALS and 1–3% of sporadic ALS patients carry a mutation in the gene encoding superoxide dismutase 1 (SOD1). In a transgenic ALS mouse model expressing the mutant SOD1G93A protein, silencing the SOD1 gene prolongs survival. One study reports a therapeutic effect of silencing the SOD1 gene in systemically treated adult ALS mice; this was achieved with a short hairpin RNA, a silencing molecule that has raised multiple safety concerns, and recombinant adeno-associated virus (rAAV) 9. We report here a silencing method based on an artificial microRNA termed miR-SOD1 systemically delivered using adeno-associated virus rAAVrh10, a serotype with a demonstrated safety profile in CNS clinical trials. Silencing of SOD1 in adult SOD1G93A transgenic mice with this construct profoundly delayed both disease onset and death in the SOD1G93A mice, and significantly preserved muscle strength and motor and respiratory functions. We also document that intrathecal delivery of the same rAAVrh10-miR-SOD1 in nonhuman primates significantly and safely silences SOD1 in lower motor neurons. This study supports the view that rAAVrh10-miR-SOD1 merits further development for the treatment of SOD1-linked ALS in humans.

Adeno‐associated virus–delivered artificial microRNA extends survival and delays paralysis in an amyotrophic lateral sclerosis mouse model

“…18,44 Thus, a systemic neonate delivery of AAV9-shRNA is unlikely to have a major impact on hSOD1 expression in corticospinal motor neurons. Systemic delivery of an AAVrh10 amiR SOD1 vector in adult SOD1 G93A mice resulted in a 27-day extension in survival 21 comparable to that reported after delivery of AAV9-shRNA vector. 44 Thomsen et al showed that hSOD1 silencing selectively in cortical but not spinal cord motor neurons with an AAV9-shRNA vector extends survival of SOD1 rats by 20 days, 45 demonstrating that the status of the cortical motor neurons is a critical determinant of survival in this model.…”

“…This notion is strengthened by a recent efficacy study with an AAV-amiR SOD1 vector infused intrathecally in non-human primates. 21…”

“…The amiR SOD1 targets the coding sequence of the human SOD1 gene, is based on the Invitrogen Block-iT PolII miR vector system, originally developed in the laboratory of David Turner (US Patent No 2004/0053876), and uses the endogenous murine miR-155 flanking sequences (21). The full tandem sequence is as follows, with the guide strand underlined and the spacer sequence in bold letters: CCTCTTGCTGAAGGCTGTATGCTG ATGAACATGGAATCCATGCAGG TTTTGGCCACTGACTGACCTGCATGGTCCATGTTCATCAGGACACAAGGCCTGTTACTAGCACTCACATTGGC CCA GAT CCTCTGCTGAAGGCTGTATGCTG ATGAACATGGAATCCATGCAGG TTTTGGCCACTGACTGACCTGCATGGTCCATGTTCATCAGGACACAAGGCCTGTTACTAGCACTCACATTGGCC.…”

Adeno-Associated Virus Technologies and Methods for Targeted Neuronal Manipulation

“…While powerful technologies are being developed, each has technical limits which need to be considered both when designing experiments and when interpreting results. To this end, improved platforms for sharing (Borel et al, 2016;Federici et al, 2012;Gurda et al, 2016;Samaranch et al, 2013) AAV4 enables transduction of ependymal cells (Liu et al, 2005) AAV SCH9 and AAV4.18 enable SVZ progenitor cell transduction (Murlidharan et al, 2015;Ojala et al, 2018) ( Gray et al, 2011;Klein et al, 1998;McCown et al, 1996;Paterna et al, 2000;Tenenbaum et al, 2004;Thomsen et al, 1984;Yaguchi et al, 2013) CAG, CMV enhancer, CBA promoter, globin intron Ubiquitous 1700 (Miyazaki et al, 1989) CAGGS, CMV immediateearly enhancer, CBA promoter, CBA intron1/exon1…”

Gene Therapy 2017: Progress and Future Directions

“…The clinical success of the Leber congenital amaurosis trial, have led to a number of studies targeting genetic diseases of the retina . Diseases of the central nervous system have also had some important proof‐of‐concept studies, along with metabolic and skeletal diseases . Additionally, rAAVs have been used to treat diseases other than monogenic disorders, such as interferon‐beta delivery to treat the aggressive brain cancer glioblastoma multiforme, and to provide treatment for infectious diseases, such as human immunodeficiency virus and influenza …”