Therapeutic hypercapnia prevents bleomycin-induced pulmonary hypertension in neonatal rats by limiting macrophage-derived tumor necrosis factor-α

Abstract

Sewing AC, Kantores C, Ivanovska J, Lee AH, Masood A, Jain A, McNamara PJ, Tanswell AK, Jankov RP. Therapeutic hypercapnia prevents bleomycin-induced pulmonary hypertension in neonatal rats by limiting macrophage-derived tumor necrosis factor-␣. Am J Physiol Lung Cell Mol Physiol 303: L75-L87, 2012. First published May 11, 2012; doi:10.1152/ajplung.00072.2012.-Bleomycin-induced lung injury is characterized in the neonatal rat by inflammation, arrested lung growth, and pulmonary hypertension (PHT), as observed in human infants with severe bronchopulmonary dysplasia. Inhalation of CO2 (therapeutic hypercapnia) has been described to limit cytokine production and to have anti-inflammatory effects on the injured lung; we therefore hypothesized that therapeutic hypercapnia would prevent bleomycin-induced lung injury. Spontaneously breathing rat pups were treated with bleomycin (1 mg/kg/d ip) or saline vehicle from postnatal days 1-14 while being continuously exposed to 5% CO2 (PaCO 2 elevated by 15-20 mmHg), 7% CO2 (PaCO 2 elevated by 35 mmHg), or normocapnia. Bleomycin-treated animals exposed to 7%, but not 5%, CO2, had significantly attenuated lung tissue macrophage influx and PHT, as evidenced by normalized pulmonary vascular resistance and right ventricular systolic function, decreased right ventricular hypertrophy, and attenuated remodeling of pulmonary resistance arteries. The level of CO2 neither prevented increased tissue neutrophil influx nor led to improvements in decreased lung weight, septal thinning, impaired alveolarization, or decreased numbers of peripheral arteries. Bleomycin led to increased expression and content of lung tumor necrosis factor (TNF)-␣, which was found to colocalize with tissue macrophages and to be attenuated by exposure to 7% CO2. Inhibition of TNF-␣ signaling with the soluble TNF-2 receptor etanercept (0.4 mg/kg ip from days 1-14 on alternate days) prevented bleomycin-induced PHT without decreasing tissue macrophages and, similar to CO2, had no effect on arrested alveolar development. Our findings are consistent with a preventive effect of therapeutic hypercapnia with 7% CO2 on bleomycin-induced PHT via attenuation of macrophage-derived TNF-␣. Neither tissue macrophages nor TNF-␣ appeared to contribute to arrested lung development induced by bleomycin. That 7% CO2 normalized pulmonary vascular resistance and right ventricular function without improving inhibited airway and vascular development suggests that vascular hypoplasia does not contribute significantly to functional changes of PHT in this model. carbon dioxide; inflammation; neonatal lung injury BRONCHOPULMONARY DYSPLASIA (BPD) is a chronic pneumopathy affecting extremely premature infants who frequently require supplemental oxygen and/or mechanical ventilation. The incidence of BPD is inversely proportional to the gestational age at which infants are born, with an incidence approaching 60% in the smallest survivors (4). The cardinal feature of BPD, as observed in the current era, is an inhibition or arrest of alveolar and ...

Leukotriene B4mediates macrophage influx and pulmonary hypertension in bleomycin-induced chronic neonatal lung injury

“…In neonatal rats, our laboratory and others have reported that repeated systemic administration of bleomycin leads to a selective decrease in lung growth, along with arrested alveolarization, vascular hypoplasia, and chronic PHT (15,30,44,52), similar to the lung pathology observed in human infants with severe BPD. We have employed this model to demonstrate a critical role for macrophage influx and macrophagederived tumor necrosis factor (TNF)-␣ in the pathogenesis of chronic PHT (26,44). In the present study, we hypothesized that LTs are upregulated in bleomycin-induced lung injury, and that inhibition of LT biosynthesis or signaling would attenuate inflammation and consequent chronic PHT.…”

“…RNA was extracted and reverse transcribed, and quantitative PCR was performed as previously described (44). Primer sequences of genes of interest are listed in Table 1.…”

Arginase inhibition prevents bleomycin-induced pulmonary hypertension, vascular remodeling, and collagen deposition in neonatal rat lungs

“…RNA was extracted and reverse transcribed, and qPCR was performed as previously described (30). Rat primers for cytokines and chemokines upregulated by exposure to bleomycin and for neuronal NOS (NOS1), NOS2, and endothelial NOS (NOS3) were previously published (8,50). Primer sequences for arginases were as follows: arginase I, forward (5=-3=) TACCTGCTGGGAAGGAAGAA and reverse (5=-3=) ACTGCCGTGTTCACAAGTACG; arginase II, forward (5=-3=) ACACTGGGAGGAGACCACAG and reverse (5=-3=) GCAAGGTTTGATCCAGGAAA.…”

“…Previous studies from our group have established a model of repeated systemic bleomycin injection in neonatal rats that results in lung injury mimicking characteristics typical of BPD. This model is a useful tool to help understand mechanisms contributing to lung development and remodeling (31) but also to study the effects of therapeutic interventions aimed at preventing lung parenchymal and vascular injury (31,50,56).The chemotherapeutic agent bleomycin sulfate causes a pulmonary inflammatory and fibrotic response in rodents when instilled as a single intratracheal dose (27) or by repeated intraperitoneal injection (3). Bleomycin-induced lung injury is characterized by induction of proinflammatory cytokines (18), influx of macrophages and other inflammatory cells (23), "emphysematous" lung morphology, and severe PHT (49, 60).…”

“…Previous studies from our group have established a model of repeated systemic bleomycin injection in neonatal rats that results in lung injury mimicking characteristics typical of BPD. This model is a useful tool to help understand mechanisms contributing to lung development and remodeling (31) but also to study the effects of therapeutic interventions aimed at preventing lung parenchymal and vascular injury (31,50,56).…”