Theiler's Murine Encephalomyelitis Virus Leader Protein Amino Acid Residue 57 Regulates Subgroup-Specific Virus Growth on BHK-21 Cells

mentioning

confidence: 82%

mentioning

confidence: 99%

Encephalomyocarditis Virus Leader Is Phosphorylated by CK2 and Syk as a Requirement for Subsequent Phosphorylation of Cellular Nucleoporins

Basta

Bacot‐Davis

Ciomperlik

et al. 2014

“…The construct was digested with MluI, and following religation, the resultant MluI site was deleted with PCR using the forward primer GACGTCTTCTGGCCTGACTACCGCTCGTACG and reverse primer CG TACGAGCGGTAGTCAGGCCAGAAGACGTC. The DApro 57 virus (in which proline, the amino acid normally found at position 57 in GDVII L, replaced the serine that is found in DA L) and GDVIIser 57 virus (in which serine, the amino acid normally found at position 57 of DA L, replaced the proline that is normally found in GDVII L) were provided by Yoshiro Ohara (24).…”

Section: Methodsmentioning

confidence: 99%

“…2B) suggested that the serine/threonine domain of DA L is important in its apoptotic activity. We next focused on amino acid 57, which is within this domain, since this amino acid has been implicated in TMEV subgroup-specific growth in BHK-21 cells (24). Of note, this amino acid is serine in the case of all TO subgroup strains and proline in the case of GDVII subgroup strains.…”

Section: Da L Is Proapoptotic In Hela Cells Following Da Virus Infectmentioning

confidence: 99%

Apoptotic and Antiapoptotic Activity of L Protein of Theiler's Murine Encephalomyelitis Virus

Stavrou¹,

Ghadge²

2011

Viruses frequently have genes with proapoptotic or antiapoptotic activity that may vary in different cell types. The apoptosis that is induced can trigger either a protective or destructive immune response, thereby facilitating virus clearance or persistence of the virus. Apoptotic and antiapoptotic genes have been identified in a number of picornaviruses (reviewed in reference 1). Genes regulating apoptosis in Theiler's murine encephalomyelitis virus (TMEV) have been of special interest because of their potential importance in the pathogenesis of TMEV-induced diseases (reviewed in reference 16).TMEV is a member of the Theilovirus species of the Cardiovirus genus of the Picornaviridae; the Cardiovirus genus also includes the Encephalomyocarditis virus (EMCV) species, which comprises EMCV and mengovirus. TMEV strains can be divided into two subgroups on the basis of their differing biological properties. The GDVII strain and other members of the GDVII subgroup of TMEV are highly virulent and produce a fatal, acute polioencephalomyelitis in mice with no persistence of the virus. In contrast, DA, BeAn, and other members of the less-virulent TO subgroup induce an early transient subclinical neuronal disease followed by a chronic progressive inflammatory demyelination, TMEV-induced demyelinating disease (TMEV-IDD), with persistence of the virus in the central nervous system (CNS) for the life of the mouse. During TMEV-IDD, relatively large amounts of the TMEV genome persist in oligodendrocytes and microglia, with low levels of infectious virus and viral antigen, i.e., there is a restricted expression of DA viral proteins. TMEV-IDD serves as a model of multiple sclerosis because of the similarity in the demyelinating pathology and because the immune system appears to contribute to pathology in both disorders. The remarkable disease phenotype of TO subgroup strains has made TMEV a subject of continuing interest.Apoptosis has been described during early infection of mice with strains from both subgroups of TMEV and during the late TMEV-IDD. During TMEV-IDD, apoptosis of T cells, microglia/macrophages, and oligodendrocytes has been described (2,5,20,26). In vitro studies have implicated the cardiovirus L protein, which is encoded between the start of the polyprotein and the P1 capsid proteins (Fig. 1), in regulating apoptosis. In vitro studies of TMEV carried out by Fan et al. (9) showed that transfection of an expression construct of BeAn L into BHK-21 cells and a mouse macrophage cell line led to cell death and apoptosis, while Romanova et al. (18) found that L of other cardioviruses has antiapoptotic activity, since infection with a mengovirus with a mutation in the L zinc-binding domain led to apoptosis of HeLa cells that was not seen following wild-type (wt) mengovirus infection. In order to clarify the latter observations and further characterize the apoptotic activity of TMEV, we investigated apoptosis in different cell types following transfection of DA and GDVII L expression constructs and following infection ...

“…The majority of the sequence variation between NIHE and the other strains was clustered within the Ser/Thr-rich domain (62.5%) and the Theilo domain (79.5%). Interestingly, two positions in the Ser/Thr-rich region (L-55 and L-57) and one in the L-VP4 cleavage site (L-70) have been identified previously as distinguishing between the GDVII and TO strains (27,35). In all three instances, the NIHE sequence segregates with the TO strains.…”

mentioning

confidence: 81%

Identification of a Novel Neuropathogenic Theiler's Murine Encephalomyelitis Virus

Buckwalter

Nga

Gouilh

et al. 2011

Theiler's murine encephalitis viruses (TMEV) are divided into two subgroups based on their neurovirulence. Persistent strains resemble Theiler's original viruses (referred to as the TO subgroup), which largely induce a subclinical polioencephalomyelitis during the acute phase of the disease and can persist in the spinal cord of susceptible animals, inducing a chronic demyelinating disease. In contrast, members of the neurovirulent subgroup cause an acute encephalitis characterized by the rapid onset of paralysis and death within days following intracranial inoculation. We report herein the characterization of a novel neurovirulent strain of TMEV, identified using pyrosequencing technology and referred to as NIHE. Complete coverage of the NIHE viral genome was obtained, and it shares <90% nucleotide sequence identity to known TMEV strains irrespective of subgroup, with the greatest sequence variability being observed in genes encoding the leader and capsid proteins. The histopathological analysis of infected brain and spinal cord demonstrate inflammatory lesions and neuronal necrosis during acute infection with no evidence of viral persistence or chronic disease. Intriguingly, genetic analysis indicates the putative expression of the L* protein, considered a hallmark of strains within the persistent subgroup. Thus, the identification and characterization of a novel neurovirulent TMEV strain sharing features previously associated with both subgroups will lead to a deeper understanding of the evolution of TMEV strains and new insights into the determinants of neurovirulence.Theilioviruses have positive-sense, single-stranded RNA genomes and are members of the Picornaviridae family and the Cardiovirus genus. Several serotypes have been identified, causing disease in rodents, such as Theiler's murine encephalomyelitis virus (TMEV) (36, 37) and rat Theiler-like virus (RTV) (28), and humans, such as Vilyuisk human encephalomyelititis virus (VHEV) (6) and Saffold viruses (7,13,44). TMEV is an enteric pathogen that follows the fecal-oral route of infection; however, when inoculated intracranialy (IC), it can cause severe pathology in susceptible mouse strains. As a natural mouse pathogen, TMEV provides a valuable experimental model for understanding host-pathogen interactions. The TMEV serotype is divided into two subgroups based on the pathogenesis of the disease. Members of the TO subgroup, so named because they resemble Theiler's original strains (36), cause a biphasic infection. The early phase is an acute poliomyelitis characterized by viral replication in the neurons of the brain (1, 18). During the late phase of infection, the virus progresses from the gray to the white matter of the spinal cord, where, depending on the genetics of the mouse strain (4), it can persist for the life of the animal within various cell types (2, 21), causing in some instances chronic demyelination (19). In contrast, the second subgroup, consisting of the GDVII and FA strains, are neurovirulent, and their pathology is characterized by a...