The yeast cell wall integrity pathway signals from recycling endosomes upon elimination of phosphatidylinositol (4,5)-bisphosphate by mammalian phosphatidylinositol 3-kinase

Fernández-Acero, Teresa; Rodríguez-Escudero, Isabel; Molina, Marı́a; Cid, Víctor J.

doi:10.1016/j.cellsig.2015.08.004

Cited by 15 publications

(15 citation statements)

References 81 publications

(105 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…CW growth is supported by actin-driven polarized secretion involving local activation of the Rho1 small GTPase 41 . The localization of the Rho1-activated protein kinase C Pkc1 serves as a spatial marker for sites of Rho1 activation 42 , 43 . Interestingly, abnormally located GFP-Pkc1 co-localized with some mCherry-Akt3 invaginations (Fig.…”

Section: Resultsmentioning

confidence: 99%

“…For statistics on cell populations >100 cells were counted for each experiment. Observation of actin in yeast cells with rhodamine-conjugated phalloidin (Sigma, St. Louis, MO, USA) was performed as previously described 43 . Latrunculin A (Sigma, St. Louis, MO, USA) was added at 80 µM at the time of galactose induction and samples were collected each hour and analysed.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Heterologous mammalian Akt disrupts plasma membrane homeostasis by taking over TORC2 signaling in Saccharomyces cerevisiae

Rodríguez-Escudero

Fernández-Acero

Cid

et al. 2018

Sci Rep

Self Cite

View full text Add to dashboard Cite

The Akt protein kinase is the main transducer of phosphatidylinositol-3,4,5-trisphosphate (PtdIns3,4,5P3) signaling in higher eukaryotes, controlling cell growth, motility, proliferation and survival. By co-expression of mammalian class I phosphatidylinositol 3-kinase (PI3K) and Akt in the Saccharomyces cerevisiae heterologous model, we previously described an inhibitory effect on yeast growth that relied on Akt kinase activity. Here we report that PI3K-Akt expression in yeast triggers the formation of large plasma membrane (PM) invaginations that were marked by actin patches, enriched in PtdIns4,5P2 and associated to abnormal intracellular cell wall deposits. These effects of Akt were mimicked by overproduction of the PtdIns4,5P2 effector Slm1, an adaptor of the Ypk1 and Ypk2 kinases in the TORC2 pathway. Although Slm1 was phosphorylated in vivo by Akt, TORC2-dependent Ypk1 activation did not occur. However, PI3K-activated Akt suppressed the lethality derived from inactivation of either TORC2 or Ypk protein kinases. Thus, heterologous co-expression of PI3K and Akt in yeast short-circuits PtdIns4,5P2- and TORC2-signaling at the level of the Slm-Ypk complex, overriding some of its functions. Our results underscore the importance of phosphoinositide-dependent kinases as key actors in the homeostasis and dynamics of the PM.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Heterologous mammalian Akt disrupts plasma membrane homeostasis by taking over TORC2 signaling in Saccharomyces cerevisiae

Rodríguez-Escudero

Fernández-Acero

Cid

et al. 2018

Sci Rep

Self Cite

View full text Add to dashboard Cite

show abstract

“…Dpp1p is a diacylglycerol diphosphate phosphatase, which synthesizes the second messenger diacylglycerol, a potential activator of protein kinase C of the CWI signalling cascade. Csr1p is a phosphatidylinositol transfer protein belonging to the Sec14‐family, which has a potential role in regulating lipid and fatty acid metabolism and indicates turnover of phosphoinositides in response to different forms of cell wall stress, possibly, to relocate proteins involved in CWI signalling, such as Wsc1p, Rho1p, Rom2p and Pkc1p to the proper location at the membrane (Fernández‐Acero et al, ). The limited overlap of genes between the various treatments could have multiple reasons and might relate to the fact that treatments with antifungals provoke both short‐term and transient responses, while the ΔugmA mutant is fully adapted to the lack of Gal f biosynthesis and therefore represents a long‐term adaptation.…”

Section: Discussionmentioning

confidence: 99%

Transcriptomic and molecular genetic analysis of the cell wall salvage response ofAspergillus nigerto the absence of galactofuranose synthesis

Park

Hulsman

Arentshorst

et al. 2016

Cellular Microbiology

View full text Add to dashboard Cite

SummaryThe biosynthesis of cell surface‐located galactofuranose (Galf)‐containing glycostructures such as galactomannan, N‐glycans and O‐glycans in filamentous fungi is important to secure the integrity of the cell wall. UgmA encodes an UDP‐galactopyranose mutase, which is essential for the formation of Galf. Consequently, the ΔugmA mutant lacks Galf‐containing molecules. Our previous work in Aspergillus niger work suggested that loss of function of ugmA results in activation of the cell wall integrity (CWI) pathway which is characterized by increased expression of the agsA gene, encoding an α‐glucan synthase. In this study, the transcriptional response of the ΔugmA mutant was further linked to the CWI pathway by showing the induced and constitutive phosphorylation of the CWI‐MAP kinase in the ΔugmA mutant. To identify genes involved in cell wall remodelling in response to the absence of galactofuranose biosynthesis, a genome‐wide expression analysis was performed using RNAseq. Over 400 genes were higher expressed in the ΔugmA mutant compared to the wild‐type. These include genes that encode enzymes involved in chitin (gfaB, gnsA, chsA) and α‐glucan synthesis (agsA), and in β‐glucan remodelling (bgxA, gelF and dfgC), and also include several glycosylphosphatidylinositol (GPI)‐anchored cell wall protein‐encoding genes. In silico analysis of the 1‐kb promoter regions of the up‐regulated genes in the ΔugmA mutant indicated overrepresentation of genes with RlmA, MsnA, PacC and SteA‐binding sites. The importance of these transcription factors for survival of the ΔugmA mutant was analysed by constructing the respective double mutants. The ΔugmA/ΔrlmA and ΔugmA/ΔmsnA double mutants showed strong synthetic growth defects, indicating the importance of these transcription factors to maintain cell wall integrity in the absence of Galf biosynthesis.

show abstract

“…The mitochondrial marker Ilv6-mCherry, encoded in the plasmid YEplac112-Ilv6-mCherry, was constructed by amplifying 280 bp of the ILV6 promoter region followed by its coding sequence with primers containing SphI-BamHI flanking sites (ACATGCATGCTGAGTGCTTATCTAGGATG and CGGGATCCACCAGGTGGTAGTTGGG), and further subcloning into YEplac112-mCherry [45].…”

Section: Plasmidsmentioning

confidence: 99%

Expression of Human PTEN-L in a Yeast Heterologous Model Unveils Specific N-Terminal Motifs Controlling PTEN-L Subcellular Localization and Function

Fernández-Acero

Bertalmio

Luna

et al. 2019

Cells

Self Cite

View full text Add to dashboard Cite

The tumour suppressor PTEN is frequently downregulated, mutated or lost in several types of tumours and congenital disorders including PHTS (PTEN Hamartoma Tumour Syndrome) and ASD (Autism Spectrum Disorder). PTEN is a lipid phosphatase whose activity over the lipid messenger PIP3 counteracts the stimulation of the oncogenic phosphatidylinositol 3-kinase (PI3K) pathway. Recently, several extended versions of PTEN produced in the cell by alternative translation initiation have been described, among which, PTEN-L and PTEN-M represent the longest isoforms. We previously developed a humanized yeast model in which the expression of PI3K in Saccharomyces cerevisiae led to growth inhibition that could be suppressed by co-expression of PTEN. Here, we show that the expression of PTEN-L and PTEN-M in yeast results in robust counteracting of PI3K-dependent growth inhibition. N-terminally tagged GFP-PTEN-L was sharply localized at the yeast plasma membrane. Point mutations of a putative membrane-binding helix located at the PTEN-L extension or its deletion shifted localization to nuclear. Also, a shift from plasma membrane to nucleus was observed in mutants at basic amino acid clusters at the PIP2-binding motif, and at the Cα2 and CBR3 loops at the C2 domain. In contrast, C-terminally tagged PTEN-L-GFP displayed mitochondrial localization in yeast, which was shifted to plasma membrane by removing the first 22 PTEN-L residues. Our results suggest an important role of the N-terminal extension of alternative PTEN isoforms on their spatial and functional regulation.

show abstract

The yeast cell wall integrity pathway signals from recycling endosomes upon elimination of phosphatidylinositol (4,5)-bisphosphate by mammalian phosphatidylinositol 3-kinase

Cited by 15 publications

References 81 publications

Heterologous mammalian Akt disrupts plasma membrane homeostasis by taking over TORC2 signaling in Saccharomyces cerevisiae

Heterologous mammalian Akt disrupts plasma membrane homeostasis by taking over TORC2 signaling in Saccharomyces cerevisiae

Transcriptomic and molecular genetic analysis of the cell wall salvage response ofAspergillus nigerto the absence of galactofuranose synthesis

Expression of Human PTEN-L in a Yeast Heterologous Model Unveils Specific N-Terminal Motifs Controlling PTEN-L Subcellular Localization and Function

Contact Info

Product

Resources

About