The Type I Interferon Signaling Pathway Is a Target for Glucocorticoid Inhibition

Flammer, Jamie R.; Dobrovolná, Jana; Kennedy, Megan A.; Chinenov, Yurii; Glass, Christopher K.; Ivashkiv, Lionel B.; Rogatsky, Inez

doi:10.1128/mcb.00146-10

Cited by 127 publications

(120 citation statements)

References 61 publications

Supporting

Mentioning

104

Contrasting

Unclassified

Order By: Relevance

“…The GRIP1 corepressor activity, at least in vitro, was localized to a unique repression domain (RD) encompassing GRIP1 amino acids 767-1006, which is not shared by other p160 family members (32) and contains no predicted structural motifs or enzymatic activities. Instead, we discovered that RD participates in protein:protein interactions with several transcriptional regulators including members of the IRF family and the histone methyltransferase Suv4-20h1 (33)(34)(35). Conceivably, the RD-interacting secondary GR corepressor mediating GRIP1 actions at tethering elements awaits identification.…”

Section: Discussionmentioning

confidence: 99%

“…Indeed, GRIP1 has a wide-ranging specificity of protein:protein interactions, including those with MEF2C, MyoD, and IRFs (33,35,38,39), regulating processes as diverse as muscle-cell differentiation and innate immune response to double-stranded RNA. What promotes the preferential targeting of GRIP1 to a specific regulatory complex or its ability to inhibit or activate transcription is unknown, but recently discovered GRIP1 posttranslational modifications such as SUMOylation and phosphorylation (40,41) may serve as such a mechanism.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Role of transcriptional coregulator GRIP1 in the anti-inflammatory actions of glucocorticoids

Chinenov

Gupte²,

Dobrovolná³

et al. 2012

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

View full text Add to dashboard Cite

Inhibition of cytokine gene expression by the hormone-activated glucocorticoid receptor (GR) is the key component of the antiinflammatory actions of glucocorticoids, yet the underlying molecular mechanisms remain obscure. Here we report that glucocorticoid repression of cytokine genes in primary macrophages is mediated by GR-interacting protein (GRIP)1, a transcriptional coregulator of the p160 family, which is recruited to the p65-occupied genomic NFκB-binding sites in conjunction with liganded GR. We created a mouse strain enabling a conditional hematopoietic cell-restricted deletion of GRIP1 in adult animals. In this model, GRIP1 depletion in macrophages attenuated in a dose-dependent manner repression of NFκB target genes by GR irrespective of the upstream Toll-like receptor pathway responsible for their activation. Furthermore, genome-wide transcriptome analysis revealed a broad derepression of lipopolysaccharide (LPS)-induced glucocorticoid-sensitive targets in GRIP1-depleted macrophages without affecting their activation by LPS. Consistently, conditional GRIP1-deficient mice were sensitized, relative to the wild type, to a systemic inflammatory challenge developing characteristic signs of LPS-induced shock. Thus, by serving as a GR corepressor, GRIP1 facilitates the anti-inflammatory effects of glucocorticoids in vivo.inflammation | macrophage transcriptome | transcriptional regulation | coactivators | corepressors

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Role of transcriptional coregulator GRIP1 in the anti-inflammatory actions of glucocorticoids

Chinenov

Gupte²,

Dobrovolná³

et al. 2012

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

View full text Add to dashboard Cite

show abstract

“…Random-primed cDNA synthesis, quantitative PCR (qPCR) using SYBR green master mix with ROX (Fermentas), and cycle threshold (⌬⌬C T ) analysis were performed as described elsewhere, with ␤-actin as the normalization control. Primer pairs for target genes were as described previously (11,34) except for Per1, for which the primers were hPer1_F (ACTCCCCTATCCGCTTCTGTGCC) and hPer1_R (GGCCCAACACG AAGGCTACCTTG).…”

Section: Methodsmentioning

confidence: 99%

“…Surprisingly, recent studies identified GRIP1 as a coactivator for multiple interferon (IFN) regulatory factors (IRFs) at several independent steps of the type I IFN signaling network (5,11,31). Furthermore, transcriptome analyses in the mouse liver lacking GRIP1, but not other p160s, revealed a marked downregulation of multiple immune-related genes (19).…”

mentioning

confidence: 99%

“…Cofactor availability is viewed as a key variable ensuring sequence-specific transcription complex formation and function. Indeed, we previously reported that in macrophages, which express little GRIP1 protein, GR and IRFs recruit GRIP1 in a mutually exclusive manner and that activation of GR inhibits the IRF-dependent gene expression program and vice versa (11,31). Although this model may explain cell type-specific patterns in gene expression, in a given cell, the same coregulators are in principle equally available to multiple factors, suggesting either that cofactor recruitment is stochastic or that other mechanisms may contribute to their pathway-specific utilization.…”

mentioning

confidence: 99%

See 1 more Smart Citation

Glucocorticoid-Dependent Phosphorylation of the Transcriptional Coregulator GRIP1

Dobrovolná

Chinenov

Kennedy

et al. 2012

Molecular and Cellular Biology

Self Cite

View full text Add to dashboard Cite

Much of the regulatory diversity in eukaryotic transcription is provided by coregulators, which are recruited by DNA-binding factors to propagate signaling to basal machinery or chromatin. p160 family members, including the glucocorticoid receptor (GR)-interacting protein 1 (GRIP1), function as coactivators for GR, a ligand-dependent transcription factor of the nuclear receptor superfamily. Unlike other p160s, GRIP1 also potentiates GR-mediated repression of AP1 and NF-B targets and, surprisingly, transcriptional activation by interferon regulatory factors. What enables GRIP1 activating or repressing properties or discrimination between physiologically antagonistic pathways is unknown. We found that endogenous GRIP1 in mammalian cells undergoes glucocorticoid-induced, GR interaction-dependent phosphorylation and identified one constitutive and six inducible phosphorylation sites and two putative GRIP1 kinases, casein kinase 2 and cyclin-dependent kinase 9. We raised phosphospecific antibodies to the four closely spaced sites in a previously uncharacterized part of GRIP1 which, combined with mutagenesis, revealed the conservation of GRIP1 phosphorylation across several cell types and species and its functional relevance to GRactivated transcription and to response element-specific recruitment of phospho-GRIP1 to native GR targets. We propose that cofactor engagement by GR is neither passive nor stochastic; rather, GR actively imparts modifications that dictate GRIP1 function in a subset of complexes, adding a layer of specificity to GR transcriptional control.

show abstract

Lack of Clinical Benefit of Interferon β-1a Among Patients With Severe Acute Respiratory Distress Syndrome

Shankar-Hari

Calfee

2020

JAMA

View full text Add to dashboard Cite

In acute respiratory distress syndrome (ARDS), the alveolarcapillary units are disrupted, with lung endothelial and epithelial injury resulting in exudative pulmonary edema containing inflammatory mediators, solutes, proteins, and leukocytes. 1 Treating pulmonary endothelial injury in ARDS may improve patient outcomes. Interferon β-1a (IFN-β-1a), a type 1 IFN, is one such treatment that may improve pulmonary endothelial barrier function. In addition to its myriad immunologic effects, IFN-β-1a upregulates cluster of differentiation 73 (CD73) on pulmonary endothelial cells, thereby increasing extracellular adenosine concentrations, which acting via adenosine receptors improves pulmonary endothelial barrier function through junctional reorganization, cytoskeleton rearrangement, and further transcriptional upregulation of CD73. [2][3][4] Based on these preclinical experimental observations, the clinical utility of IFN-β-1a for ARDS was previously tested by Bellingan and colleagues 5 in an open-label, phase 1/2 dosefinding study in adult patients with ARDS, with 28-day mortality as the primary end point. In this nonrandomized study, IFN-β-1a was administered in escalating doses, with an optimum tolerated dose of 10 μg. Among the 37 patients who received IFN-β-1a, mortality was 8% compared with a higher mortality rate of 32.2% among 59 control patients (recruited contemporaneously but not randomized). This mortality difference, albeit in a nonrandomized sample, prompted the authors to design an efficacy trial.In this issue of JAMA, Ranieri and colleagues 6 report the results of a clinical trial in which 301 adults admitted with moderate or severe ARDS based on the Berlin definition 7 were randomized to receive intravenous IFN-β-1a (10 μg) or placebo once daily for 6 days. The trial enrolled patients from 74 intensive care units in 8 European countries between December 2015 and December 2017. A novel approach was used to con-

show abstract

The Type I Interferon Signaling Pathway Is a Target for Glucocorticoid Inhibition

Cited by 127 publications

References 61 publications

Role of transcriptional coregulator GRIP1 in the anti-inflammatory actions of glucocorticoids

Role of transcriptional coregulator GRIP1 in the anti-inflammatory actions of glucocorticoids

Glucocorticoid-Dependent Phosphorylation of the Transcriptional Coregulator GRIP1

Lack of Clinical Benefit of Interferon β-1a Among Patients With Severe Acute Respiratory Distress Syndrome

Contact Info

Product

Resources

About