The Tungsten Formylmethanofuran Dehydrogenase from Methanobacterium Thermoautotrophicum Contains Sequence Motifs Characteristic for Enzymes Containing Molybdopterin Dinucleotide

Abstract

Formylmethanofuran dehydrogenases arc molybdenum or tungsten iron-sulfur proteins containing a pterin dinucleolide cofactor. We report here on the primary structures of the four subunits FwdABCD of the tungsten enzyme from Methmohucteriuni thermoautcltrrii~hic.unz which were dctermincd by cloning and sequencing the encoding genes jwdABCD. FwdB was found to contain sequence motifs characteristic for molybdopterin-dinucleotidc-containing cnzytncs indicating that this subunit harbors the active site. FwdA, FwdC and FwdD showed no significant sequcnce similarity lo proteins in the diila bases. Northern blot analysis revealed that the four j w d genes form a transcription unit together with three additional genes designatedfwdE,fwdF andfwdC. A 17.8-kDa protein and an 8.6-kDa protein, both containing two 14Fe-4SI cluster binding motifs, were deduced frotii f w d E and fwdC. The open reading frame ,fivdF encodes a 38.6-kDa protein containing eight binding motifs for [4Fe-4S] clusters suggesting the gene product to be a novel polyferredoxin. All seven fwtl gcnes were expresscd i n Esclwrichiu coli yielding proteins of the expecled size. Thefwd operon was found to be located in a region of the M. thernroautotruphicum genome encoding molybdenum enzymes and proteins involved i ti iiiolybdopterin hiosynthesis.Kt?ywurds: methanogenic Archaea; tungsten enzymes; molybdenum enzymes; molybdopterin; iron-sulfui proteins.Formylmethanofuran dchydrogenasc is an enzyme found in methanogenic and sulfate-reducing Archaea. It catalyzes the reversible dehydrogenation of formylmethanofuran to CO, and methanofuran (E" = -530 mV). The reaction is iiivolved in C 0 7 reduction to methane, in autotrophic CO, fixation, and i n CO, formation from reduced C, units (Bertram and Thauer, 1994;Wasserfallen, 1994; Vorholt ct al., 1995).Fortnylrnetlianofuran dehydrogenases are either molybdenum or tungsten iron-sulfur proteins. The tungsten seems to be bound to the satiic skeleton as the molybdenum in the so-callcd molybdopterin djnucleotide cofactor (Karrasch et al., 1990; Bijrner et al., 1991). In Methanobacterium wo(fei and Mr,thanobmcterium thermoaututrnphicum two isoenzymes of formylmethanofuran dehydrogenase are found, one containing molybdenum and the other tungsten (Schmitz ct al., 1992a,b; Bertram et al., 1994a,b). In M. thermoautotrophicum the active molybdenum isoenzyme is only synthesized when molybdenum is available during growth. The active tungsten enzyme is also generated during growth of the cells on molybdate medium. Under ___-Fmd, molybdenum I'ormylmcthanofuran dehydrogenase. the latter conditions the tungstcn isocnzyme is synthesized containing mvlybdenutn rather than tungsten.The tungstcn isoenzynie of M. thermooutotro/ihicum is composed of four differenl subunits of apparent niolecular masses of65 kDa (FwdA), 53 kDa (FwdB), 31 kDa (FwdC) and IS kDa (FwdD). It contains 0.4 inol tungsten, 0.6 in01 molybdopterin guanine dinucleotide and approximatcly X inol nun-heme iron and acid-labilc sulfur/mol 160-kDa native ewytiic. Thc molyb...

Growth- and substrate-dependent transcription of the formate dehydrogenase (fdhCAB) operon in Methanobacterium thermoformicicum Z-245

“…The downstream fdhD gene has been so designated because it has sequences in common with the fdhD gene which, although its function is unknown, is closely affiliated with the fdh operon in Wolinella succinogenes (30). Although moaA and fdhD genes have not yet been identified in M. thermoformicicum, a moaA gene has been located adjacent to genes that encode a molybdopterin-dependent enzyme in M. thermoautotrophicum Marburg (14), and the M. thermoautotrophicum ⌬H genome sequence contains both moaA and fdhD genes, separated as in M. formicicum by ϳ4 kbp, but not flanking genes obviously related to formate metabolism (37).…”

The Active Species of ‘CO2’ Utilized by Formylmethanofuran Dehydrogenase from Methanogenic Archaea

“…The active site harbouring subunit of formylmethanofuran dehydrogenase exhibits sequence similarities with molybdenum formate dehydrogenases Futo and Meyer, 1986Bott and Thauer, 1989Thauer et al, 1975aKriiger, 1975Ruschig et al, 1976 this work Dalziel and Londesborough, 1968 : Dalziel, 1980 Dalziel andLondesborough, 1968;Frenkel, 1972Hilpert and Dimroth, 1983Dimroth and Thomer, 1983Cooper et al, 1968 Cooper et a]., Villet and Dalziel, 1969Krebs and Roughton, 1948Thauer et al, 19751, Cooper et al, 1969Lorimer et al, 1976Krebs and Roughton, 1948Jones et al, 1977Polakis et al, 1974Jones and Spector, 1960Raushel et al, 1978: Wimmer et al, 1979Asami et al, 1979Maruyama et al, 1966: Cooper and Wood, 197 l : Dalziel, 1980: Janc et al. 1992Kaziro et al, 1962Dalziel, 1980Cooper et al, 1968Cooper and Wood, 1971 ( Hochheimer et al, 1995Hochheimer et al, , 1996, which catalyze the dehydrogenation of formate to CO, without a free carbamate being an intermediate (Thauer et al, 1975a;Kroger, 1975). Formylmethanofuran dehydrogenase was found to catalyze a MFR+-dependent isotopic exchange between "CO, and the formyl group of formyl-MFR.…”

“…This difference between formylmethanofuran dehydrogenases and formate dehydrogenases in catalytic properties is also reflected in structural differences. Whereas in formate dehydrogenase from E. coli the molybdenum in the active site is ligated by 2 mol molybdopterin guanine dinucleotide, the molybdenum in the active site of formylmethanofuran dehydrogenase appears to be ligated to only one molybdopterin cofactor (Hochheimer et al, 1995) as in xanthine-dehydrogenase-related molybdenum enzymes (Romao et al, 1995;Hille, 1996). Xanthine dehydrogenases catalyze reactions that are analogous to those catalyzed by formylmethanofuran dehydrogenase : xanthine and formyl-MFR are both formamide derivatives and uric acid, the product of xanthine dehydrogenation, is a carbamate derivative as is carboxy-MFR ~, the postulated product of formyl-MFR dehydrogenation.…”

Hydrogen regulation of growth, growth yields, and methane gene transcription in Methanobacterium thermoautotrophicum deltaH

“…The same PCR primers were then 32 P end labeled with [␥-32 P]dATP (28) and used to amplify the product of the first PCR reaction, in a reaction mixture that contained [␣-32 P]dATP. By combining information from the M. thermoautotrophicum ⌬H genome sequencing project (20) with published sequences of related genes and N-terminal amino acid sequences (2,12,13,35), oligonucleotides were synthesized for use as probes to identify transcripts of the fwdEFGDACB (5ЈAGCTATCTCTCTCTGTGAATGGCCC; complementary to a transcript of nucleotide positions 60 to 86 within fwdE) and fmdAB (5ЈGAA CCTCTATGTCATCACAAGACCC; complementary to a transcript of nucleotide positions 39 to 63 within fmdB) operons, which encode the tungsten-and molybdenum-containing formylmethanofuran dehydrogenases, respectively; the mch gene (5ЈGACCTTTATTTTAAGGTCGTCTGCC; complementary to a transcript of nucleotide positions 83 to 107 within mch), which encodes the N 5 ,N 10 -methenyl-H 4 MPT cyclohydrolase; and the hdrA (5ЈCGTGTTTAACGG CTCCCCTTTCACAGACC; complementary to a transcript of nucleotide positions 926 to 954 within hsdA) and hdrCB (5ЈCTCAGGGAACTGGTGTGTTG TTGGTGG; complementary to a transcript of nucleotide positions 443 to 469 within hdrC) genes, which encode the subunits of the heterodisulfide reductase. Following 32 P labeling, probes were separated from unincorporated nucleotides by chromatography through a Sephadex G50 column before being used in the Northern blot procedure.…”

“…There are seven steps in the energy-generating H 2 -dependent pathway of CO 2 reduction to CH 4 (7, 33) and the enzymes that catalyze these reactions have been characterized, in detail, from strains of M. thermoautotrophicum (2,8,10,13,27,42). The methane genes that encode these enzymes have been cloned and sequenced (3,8,10,13,18,21,22,24,32,35,36), leading to the discovery of two [Ni,Fe]-hydrogenases, designated the methyl viologenreducing hydrogenase (MVH) and the coenzyme F 420 -reducing hydrogenase (FRH) (1, 25); two formylmethanofuran dehydrogenases, one containing tungsten and one containing molybdenum (2, 13); two N 5 ,N 10 -methenyltetrahydromethanopterin (methenyl-H 4 MPT) reductases, designated MTH and MTD (18,22,42); and two methyl coenzyme M reductases, designated MRI and MRII (4,24,27). These enzymes facilitate the uptake of the reductant H 2 and catalyze steps 1, 4, and 7, respectively, in the reduction of CO 2 to CH 4 (7, 33).…”