The transcriptional regulator <scp>TamR</scp> from <i><scp>S</scp>treptomyces coelicolor</i> controls a key step in central metabolism during oxidative stress

Huang, Hao; Grove, Anne

doi:10.1111/mmi.12156

Cited by 25 publications

(30 citation statements)

References 45 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…30 In contrast, S. coelicolor encodes another UrtR homologue, TamR, which is responsible for regulating the activity of genes encoding proteins involved in maintaining flux through the citric acid cycle: DNA binding by TamR is attenuated by trans -aconitate and closely related compounds but not by urate. 10 …”

Section: Discussionmentioning

confidence: 99%

Ligand-Binding Pocket Bridges DNA-Binding and Dimerization Domains of the Urate-Responsive MarR Homologue MftR from Burkholderia thailandensis

Gupta

Grove

2014

Biochemistry

Self Cite

View full text Add to dashboard Cite

Members of the multiple antibiotic resistance regulator (MarR) family often regulate gene activity by responding to a specific ligand. In the absence of ligand, most MarR proteins function as repressors, while ligand binding causes attenuated DNA binding and therefore increased gene expression. Previously, we have shown that urate is a ligand for MftR (major facilitator transport regulator), which is encoded by the soil bacterium Burkholderia thailandensis. We show here that both mftR and the divergently oriented gene mftP encoding a major facilitator transport protein are upregulated in the presence of urate. MftR binds two cognate sites in the mftR-mftP intergenic region with equivalent affinity and sensitivity to urate. Mutagenesis of four conserved residues previously reported to be involved in urate binding to Deinococcus radiodurans HucR and Rhizobium radiobacter PecS significantly reduced protein stability and DNA binding affinity but not ligand binding. These data suggest that residues equivalent to those implicated in ligand binding to HucR and PecS serve structural roles and that MftR relies on distinct residues for ligand binding. MftR exhibits a two-step melting transition suggesting independent unfolding of the dimerization and DNA-binding regions; urate binding or mutations in the predicted ligand-binding sites result in one-step unfolding transitions. We suggest that MftR binds the ligand in a cleft between the DNA-binding lobes and the dimer interface but that the mechanism of ligand-mediated attenuation of DNA binding differs from that proposed for other urate-responsive MarR homologues. Since DNA binding by MftR is attenuated at 37 °C, our data also suggest that MftR responds to both ligand and a thermal upshift by attenuated DNA binding and upregulation of the genes under its control.

show abstract

Section: Discussionmentioning

confidence: 99%

Ligand-Binding Pocket Bridges DNA-Binding and Dimerization Domains of the Urate-Responsive MarR Homologue MftR from Burkholderia thailandensis

Gupta

Grove

2014

Biochemistry

Self Cite

View full text Add to dashboard Cite

show abstract

“…Binding affinity of these ligands was analyzed by fitting the fluorescence quenching as a function of ligand concentration to the Hill equation. Urate We have previously shown that incubation of S. coelicolor TamR with urate has little effect on DNA binding, suggesting optimization of the TamR ligand-binding pocket for association with trans-aconitate and structurally related molecules (17). For PecS, we compared binding to pecO, for which halfmaximal saturation is ϳ0.1 nM, with its binding to two different promoters that are regulated by TamR (genes encoding malate dehydrogenase [SCO4827] and isocitrate dehydrogenase [SCO7000]) and found no detectable complex formation at [PecS] up to 10 nM (data not shown).…”

Section: Resultsmentioning

confidence: 99%

“…TamR, which is also encoded by pathogenic Streptomyces spp., functions to ensure metabolic flux through the citric acid cycle during oxidative stress (17). While TamR and PecS likely derive from a common ancestor yet have evolved distinct functions and ligand specificities, they apparently both function to control gene activity during oxidative stress.…”

Section: Discussionmentioning

confidence: 99%

“…We have recently reported that Streptomyces coelicolor encodes a UrtR homolog that is very similar to PecS from plant pathogens yet differs by responding to the ligand trans-aconitate and related compounds (17). This homolog, named trans-aconitate methyltransferase regulator (TamR), regulates expression of a gene encoding trans-aconitate methyltransferase and is important for metabolic flux through the citric acid cycle during oxidative stress.…”

mentioning

confidence: 99%

See 1 more Smart Citation

Streptomyces coelicolor Encodes a Urate-Responsive Transcriptional Regulator with Homology to PecS from Plant Pathogens

2013

Self Cite

View full text Add to dashboard Cite

Many transcriptional regulators control gene activity by responding to specific ligands. Members of the multiple-antibiotic resistance regulator (MarR) family of transcriptional regulators feature prominently in this regard, and they frequently function as repressors in the absence of their cognate ligands. Plant pathogens such as Dickeya dadantii encode a MarR homolog named PecS that controls expression of a gene encoding the efflux pump PecM in addition to other virulence genes. We report here that the soil bacterium Streptomyces coelicolor also encodes a PecS homolog (SCO2647) that regulates a pecM gene (SCO2646). S. coelicolor PecS, which exists as a homodimer, binds the intergenic region between pecS and pecM genes with high affinity. Several potential PecS binding sites were found in this intergenic region. The binding of PecS to its target DNA can be efficiently attenuated by the ligand urate, which also quenches the intrinsic fluorescence of PecS, indicating a direct interaction between urate and PecS. In vivo measurement of gene expression showed that activity of pecS and pecM genes is significantly elevated after exposure of S. coelicolor cultures to urate. These results indicate that S. coelicolor PecS responds to the ligand urate by attenuated DNA binding in vitro and upregulation of gene activity in vivo. Since production of urate is associated with generation of reactive oxygen species by xanthine dehydrogenase, we propose that PecS functions under conditions of oxidative stress.

show abstract

“…The orthologous proteins PenR and PntR serve as pathway-specific activators of the biosynthesis of the antibiotic phenalinolactone in Streptomyces exfoliatus and Streptomyces arenae, respectively (17). S. coelicolor TamR controls the expression of the gene encoding trans-aconitate methyltransferase (tam) and is important for metabolic flux through the citric acid cycle during oxidative stress (18). S. coelicolor PecS was proposed to function under oxidative stress conditions by responding to the ligand urate (19).…”

mentioning

confidence: 99%

A MarR Family Transcriptional Regulator, DptR3, Activates Daptomycin Biosynthesis and Morphological Differentiation in Streptomyces roseosporus

Zhang

Chen

Zhuang

et al. 2015

Appl Environ Microbiol

View full text Add to dashboard Cite

Daptomycin produced by Streptomyces roseosporus is an important lipopeptide antibiotic used to treat human infections caused by Gram-positive pathogenic bacteria, including drug-resistant strains. The genetic basis for regulatory mechanisms of daptomycin production is poorly known. Here, we characterized the dptR3 gene, which encodes a MarR family transcriptional regulator located adjacent to the known daptomycin biosynthetic (dpt) genes. Deletion of dptR3 reduced daptomycin production significantly and delayed aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of DptR3 in daptomycin production revealed that it stimulates daptomycin production indirectly by altering the transcription of dpt structural genes. DptR3 directly activated the transcription of its own gene, dptR3, but repressed the transcription of the adjacent, divergent gene orf16 (which encodes a putative ABC transporter ATP-binding protein). A 66-nucleotide DptR3-binding site in the intergenic region of dptR3-orf16 was determined by DNase I footprinting, and the palindromic sequence TCATTGTTACCTATGCTCACAATGA (underlining indicates inverted repeats) in the protected region was found to be essential for DptR3 binding. orf16, the major target gene of DptR3, exerted a positive effect on daptomycin biosynthesis. Our findings indicate that DptR3 functions as a global regulator that positively controls daptomycin production and morphological development in S. roseosporus. Streptomycetes are soil-dwelling filamentous bacteria characterized by complex morphological differentiation and the ability to produce a variety of antibiotics. The production of these antibiotics is a complex process that is usually accompanied by morphological differentiation and is controlled by multiple regulatory proteins that respond to nutritional status, population density, and a variety of environmental conditions (1-3). Generally, the lowest level of the regulatory network involves pathway-specific regulatory genes that are found within the respective antibiotic biosynthesis gene cluster and affect only a single antibiotic biosynthetic pathway.Daptomycin is a cyclic lipopeptide antibiotic used clinically to treat complex skin infections caused by Gram-positive pathogens, including 15 genera and 35 species, notably, penicillin-resistant Streptococcus pneumoniae, vancomycin-resistant Enterococcus spp., glycopeptide-insensitive Staphylococcus aureus, and methicillin-resistant S. aureus (4). Daptomycin is a minor component of the A21978C complex produced by Streptomyces roseosporus via a nonribosomal peptide synthetase (NRPS) mechanism. Components of the complex have in common a 10-membered cyclic peptide nucleus and a three-amino-acid tail with various fatty acid moieties attached to the N-terminal tryptophan (Trp) (5). The fatty acid portion of daptomycin is straight-chain decanoic acid, and daptomycin production can be increased by adding the precursor decanoic acid or sodium decanoate to the fermentation broth (6, 7).I...

show abstract

The transcriptional regulator TamR from Streptomyces coelicolor controls a key step in central metabolism during oxidative stress

Cited by 25 publications

References 45 publications

Ligand-Binding Pocket Bridges DNA-Binding and Dimerization Domains of the Urate-Responsive MarR Homologue MftR from Burkholderia thailandensis

Ligand-Binding Pocket Bridges DNA-Binding and Dimerization Domains of the Urate-Responsive MarR Homologue MftR from Burkholderia thailandensis

Streptomyces coelicolor Encodes a Urate-Responsive Transcriptional Regulator with Homology to PecS from Plant Pathogens

A MarR Family Transcriptional Regulator, DptR3, Activates Daptomycin Biosynthesis and Morphological Differentiation in Streptomyces roseosporus

Contact Info

Product

Resources

About