The synthetic antimicrobial peptide 19-2.5 attenuates septic cardiomyopathy and prevents down-regulation of SERCA2 in polymicrobial sepsis

Abstract

An impairment of cardiac function is a key feature of the cardiovascular failure associated with sepsis. Although there is some evidence that suppression of sarcoplasmic reticulum Ca2+-ATP-ase (SERCA2) contributes to septic cardiomyopathy, it is not known whether prevention of the down-regulation of SERCA2 improves outcome in sepsis. Thus, we investigated whether the administration of the synthetic antimicrobial peptide Pep2.5 may attenuate the cardiac dysfunction in murine polymicrobial sepsis through regulating SERCA2 expression. We show here for the first time that the infusion of Pep2.5 reduces the impaired systolic and diastolic contractility and improves the survival time in polymicrobial sepsis. Preservation of cardiac function in sepsis by Pep2.5 is associated with prevention of the activation of NF-κB and activation of the Akt/eNOS survival pathways. Most notably, Pep2.5 prevented the down-regulation of SERCA2 expression in a) murine heart samples obtained from mice with sepsis and b) in cardiomyocytes exposed to serum from septic shock patients. Thus, we speculate that Pep2.5 may be able to prevent down-regulation of cardiac SERCA2 expression in patients with sepsis, which, in turn, may improve cardiac function and outcome in these patients.

Inhibition of circulating dipeptidyl-peptidase 3 restores cardiac function in a sepsis-induced model in rats: A proof of concept study

“…Other authors hypothesized that the down-regulation or uncoupling of adrenergic receptors induced by sepsis can explain the absence of response to endogenous and exogenous catecholamines, leading to septic shock [ 20 ]. Furthermore, an increased oxidative stress level may be implicated in triggering myocardial dysfunction during sepsis [ 21 – 23 ]. Finally, alteration of the angiotensin II pathway is another potential, but poorly studied, mechanism implicated in septic cardiomyopathy.…”

Ribonuclease 1 attenuates septic cardiomyopathy and cardiac apoptosis in a murine model of polymicrobial sepsis

“…For this study, 10-week-old, male C57BL/6 mice were used. CLP was performed to induce polymicrobial sepsis as previously described (46,47). Surgery was performed under anesthesia by isoflurane (3%) delivered in oxygen at a rate of 1 L/min in an anesthetic chamber and maintained with isoflurane (2%) and oxygen (1 L/min) via a face mask.…”

Heparan Sulfate Induces Necroptosis in Murine Cardiomyocytes: A Medical-In silico Approach Combining In vitro Experiments and Machine Learning

“…As described previously ( 12 , 29 – 31 ), HL-1 cells (murine cardiomyocytes) were cultured in 10 cm plates coated with a gelatin/fibronectin solution [5 mg/L fibronectin (Sigma, Munich, Germany), 0.02% (w/v) gelatin (Sigma)]. Cells were cultivated in Claycomb medium (Sigma) and incubated under an atmosphere of 5% CO 2 and 95% air at 37°C.…”

“…RNA was isolated using the Trizol reagent, as described earlier ( 12 , 30 , 31 ). The following primers were used to analyze the relative mRNA expression of caspase 3 and TNF-α in the quantitative real-time PCR (StepOnePlus Real-Time PCR System; Thermo Fisher Scientific, MA, USA): caspase 3, 5′ CCAACCTCAGAGAGACATTC 3′ (for) and 5′ TTTCGGCTTTCCAGTCAGAC 3′ (rev) and TNF-α, 5′ TCCCCAAAGGGATGAGAAG 3′ (for) and 5′ GCACCACTAGTTGGTTGTC 3′ (rev).…”