The structure of the Moco carrier protein fromRippkaea orientalis

Abstract

The molybdenum cofactor (Moco) is the prosthetic group of all molybdenum-dependent enzymes except for nitrogenase. The multistep biosynthesis pathway of Moco and its function in molybdenum-dependent enzymes are already well understood. The mechanisms of Moco transfer, storage and insertion, on the other hand, are not. In the cell, Moco is usually not found in its free form and remains bound to proteins because of its sensitivity to oxidation. The green alga Chlamydomonas reinhardtii harbors a Moco carrier protein (MCP) that binds and protects Moco but is devoid of enzymatic function. It has been speculated that this MCP acts as a means of Moco storage and transport. Here, the search for potential MCPs has been extended to the prokaryotes, and many MCPs were found in cyanobacteria. A putative MCP from Rippkaea orientalis (RoMCP) was selected for recombinant production, crystallization and structure determination. RoMCP has a Rossmann-fold topology that is characteristic of nucleotide-binding proteins and a homotetrameric quaternary structure similar to that of the MCP from C. reinhardtii. In each protomer, a positively charged crevice was identified that accommodates up to three chloride ions, hinting at a potential Moco-binding site. Computational docking experiments supported this notion and gave an impression of the RoMCP–Moco complex.

Identification and characterisation of the Volvox carteri Moco carrier protein

“…states that were published for C. reinhardtii MCP [13] and R. orientalis MCP [22]. SAXS confirmed that notion of a V. carteri MCP tetramer.…”

“…The amino acid sequence comparison (Figure 1A) of eukaryotic MCPs revealed a region of low sequence homology (LHR) located in the N-terminal part of the protein sequence. Results of docking experiments published for C. reinhardtii MCP [13] as well as a bacterial MCP from R. orientalis [22] indicate that Moco binding probably occurs in a predominantly positively charged crevice that is located in proximity to the LHR. We therefore investigated the LHR's role by creating a chimeric V. carteri MCP, which had its endogenous LHR switched for its counterpart from R. orientalis MCP (Figure 6A).…”

“…For generation of the V. carteri MCP low homology region (LHR) exchange variant, the following DNA sequence was synthesised: (5 -GAATTCATTAAAGAGGAGAAATTAACTATGTCTAGAGGATCC ATGGCTCCACGCAAACCGATCATTGGCGTTATGGGACCAGGCGAACAGGCTACGCCTACGGATGTGGA ACTGGCCACCGAACTGGGCAAGCAGATTGCGAGCCATGACTGGATTCTGCTCACAGGTGGGCGTAGTC TGGGCGTGATGGATGCGGCATGC-3 ) and used to replace a DNA stretch within the V. carteri MCP expression construct by using the restriction sites EcoRI and SpeI. Doing so resulted in the exchange of the V. carteri MCP LHR region (spanning amino acids 15-26 for the Rippkaea orientalis (R. orientalis) MCP LHR region (spanning amino acids 13-19, [22]).…”

“…The nit-1 assay was conducted largely as described previously [22]. Reconstitution was conducted overnight on ice.…”

“…The NR reaction was allowed to proceed for 30 min. Formed nitrite was quantified at 540 nm [22,27,28] using a Thermo Scientific™ Multiskan™ GO Microplate Spectrophotometer.…”