The structure of the ITS2-proximal stem is required for pre-rRNA processing in yeast

Abstract

processing in yeastThe structure of the ITS2-proximal stem is required for pre-rRNA

Ngl2p is a Ccr4p-like RNA nuclease essential for the final step in 3???-end processing of 5.8S rRNA in Saccharomyces cerevisiae

“…Deletion of individual NGL genes does not impair 39-end maturation of 25S rRNA+ RNA isolated from the wild-type parental strain (lane 2) and the various ngl⌬ derivatives (lanes 3-5) was separated on a 1+2% agarose gel, blotted, and hybridized with a probe spanning the mature 39 end of 25S rRNA+ RNA isolated from an rnt1⌬ strain was used as a control (lane 1 subcellular localization of the protein remains to be established+ We have noted the presence of a strong consensus nuclear localization signal spanning residues 41-53 of Ngl2p (HKKKGKKGKKSKPI), suggesting that the protein resides in the nucle(ol)us+ Nevertheless, cytoplasmic localization of Ngl2p can not be excluded, because it is known that 60S subunits containing 39-extended forms of 5+8S rRNA can be exported from the nucleus (Briggs et al+, 1998)+ According to the model of Yeh and Lee (1990) ITS2 folds into a set of helical segments encompassing almost the whole of the spacer (Fig+ 4A)+ The 39 end of the 5+8S ϩ 30 species, the first distinct intermediate in the maturation of the 7S precursor, is located at the end of the first of these helices (helix II), which includes the terminal 2 nt of 5+8S rRNA+ Although this might explain why at this stage processing is taken over by another exonuclease, the exosome apparently is quite capable of progressing through helix IV, which is at least as, if not more, stable than helix II+ It seems more likely, therefore, that the handover (Allmang et al+, 1999) is necessitated by the decreasing distance to helix I formed by the base-paired 39 and 59 ends of 5+8S and 25S rRNAs, respectively, and ribosomal proteins associated with this structure+ Helix I has indeed been assigned a crucial role in the formation of the largesubunit rRNAs, but its disturbance already blocks the first step in ITS2 processing, that is, cleavage at C2 (Peculis & Greer, 1998;Côté & Peculis, 2001)+ Thus, it is unclear to what extent this helix is important in 39-end formation of 5+8S rRNA+ The absence of any sequence-specific recognition elements in helix I suggests that it does not act itself as a binding site for r-protein(s)+ However, this does not exclude the proximity effect as an explanation for the nuclease handover observed in 7S r 5+8S processing+…”

Eukaryote-specific rRNA expansion segments function in ribosome biogenesis

“…In cases where an ES deletion involved truncating a helix in the middle, we introduced a tetraloop to maintain stability of the helix and to minimize secondary effects. With the exception of ES4 L and ES24 L (Peculis and Greer 1998;Cote and Peculis 2001;Halic et al 2004), we have examined nearly all of the ES of the large subunit rRNA in yeast. Also, we studied a partial deletion of ES27 L , as marked in Figure 1, denoted henceforth as ES27h L to represent the deletion of the helix.…”

Self-splicing of a group I intron reveals partitioning of native and misfolded RNA populations in yeast

“…To follow the fate of the plasmid-encoded prerRNA, we used a unique 18-nt sequence tag at the 59 end of the 25S rRNA (Peculis and Greer 1998). The tag does not affect pre-rRNA processing (Peculis and Greer 1998) or splicing of the Tetrahymena intron (data not shown).…”

“…pNOY102-Tag was the gift of B. Peculis and contains a unique 18-nt sequence tag in the 59 end of the 25S rRNA (Peculis and Greer 1998). Intron sequences were inserted into pNOY102 and pNOY102-Tag by linearizing the plasmid DNA with I-PpoI.…”

“…Oligonucleotide probes complementary to the Tetrahymena group I intron (59-GGCTGTTGACCCCTTTCCCGCAATTTGA CGGTCTTGCCTTTTAAACCGATGCAATCTATTGGTTTA), yeast actin mRNA (59-GGCAATACCTGGGAACATGGTGGTAC), or 25S rRNA ''Tag'' (59-ACTCGAGAGCTTCAGTAC) (Peculis and Greer 1998) were labeled with [g-32 P]ATP and T4 polynucleotide kinase (NEB) and passed through a TE-10 Chromaspin column (Clontech). Probes were hybridized with the membrane overnight at 45°C in 13 hybridization buffer (Images kit; USB), washed twice for 5 min each at room temperature in 23 SSC/0.1% SDS, once for 15 min at room temperature in 23 SSC/0.5% SDS, twice for 15 min at 55°C in 0.23 SSC/0.1% SDS, and twice for 5 min at room temperature in 23 SSC.…”