The Structure and Complete Nucleotide Sequence of the Murine Gene Encoding Interleukin-1β Converting Enzyme (ICE)

Casano, Francesca J.; Rolando, Anna M.; Mudgett, John S.; Molineaux, Susan M.

doi:10.1006/geno.1994.1203

Cited by 59 publications

(25 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Tail DNA was isolated and genotyping was performed by PCR. For ICE knockout mice, PCR was performed to distinguish the endogenous from the disrupted ICE locus by using (a) an intronic forward primer complementary to bases 5538-5557 in the published sequence (49) (gaagagatgttacagaagcc), (b) an intronic reverse primer corresponding to bases 6054 -6074 (catgcctgaataatgatcacc) (49), and (c) a reverse primer for the insert used to create the disrupted null allele (gcgccttcccctacccgg). Wild-type animals have a single band at about 0.6 kb (a-b reaction), and homozygous knockout animals have a single band at around 0.6 kb (a-c reaction).…”

Section: Methodsmentioning

confidence: 99%

Acute systemic inflammation up-regulates secretory sphingomyelinase in vivo : A possible link between inflammatory cytokines and atherogenesis

Wong

Xie

Beatini

et al. 2000

Proc. Natl. Acad. Sci. U.S.A.

151

133

View full text Add to dashboard Cite

Inflammation plays a critical role in atherogenesis, yet the mediators linking inflammation to specific atherogenic processes remain to be elucidated. One such mediator may be secretory sphingomyelinase (S-SMase), a product of the acid sphingomyelinase gene. The secretion of S-SMase by cultured endothelial cells is induced by inflammatory cytokines, and in vivo data have implicated S-SMase in subendothelial lipoprotein aggregation, macrophage foam cell formation, and possibly other atherogenic processes. Thus, the goal of this study was to seek evidence for S-SMase regulation in vivo during a physiologically relevant inflammatory response. First, wild-type mice were injected with saline or lipopolysaccharide (LPS) as a model of acute systemic inflammation. Serum S-SMase activity 3 h postinjection was increased 2-to 2.5-fold by LPS (P < 0.01). To determine the role of IL-1 in the LPS response, we used IL-1 converting enzyme knockout mice, which exhibit deficient IL-1 bioactivity. The level of serum S-SMase activity in LPS-injected IL-1 converting enzyme knockout mice was Ϸ35% less than that in identically treated wild-type mice (P < 0.01). In LPS-injected IL-1-receptor antagonist knockout mice, which have an enhanced response to IL-1, serum S-SMase activity was increased 1.8-fold compared with LPS-injected wild-type mice (P < 0.01). Finally, when wild-type mice were injected directly with IL-1␤, tumor necrosis factor ␣, or both, serum S-SMase activity increased 1.6-, 2.3-, and 2.9-fold, respectively (P < 0.01). These data show regulation of S-SMase activity in vivo and they raise the possibility that local stimulation of S-SMase may contribute to the effects of inflammatory cytokines in atherosclerosis.

show abstract

Section: Methodsmentioning

confidence: 99%

Acute systemic inflammation up-regulates secretory sphingomyelinase in vivo : A possible link between inflammatory cytokines and atherogenesis

Wong

Xie

Beatini

et al. 2000

Proc. Natl. Acad. Sci. U.S.A.

151

133

View full text Add to dashboard Cite

show abstract

“…1A). These two domains are located within one exon in the murine casp-1 gene [38], the human casp-1 gene [39] and the ced-3 gene [7]. We used both murine genomic DNA as well as murine cDNA derived from L929r2 cells as PCR template: the former in order to isolate CASPs independent of cell-specific expression patterns, the latter with the intention not to miss homologs with an exon-intron boundary between the SHG and QACRG boxes of homology.…”

Section: Cloning Of Seven Mcaspsmentioning

confidence: 99%

Characterization of seven murine caspase family members

et al. 1997

View full text Add to dashboard Cite

Seven members of the murine caspase (mCASP) family were cloned and functionally characterized by transient overexpression: mCASP-1 (mICE), mCASP-2 (Ichl), mCASP-3 (CPP32), mCASP-6 (Mch2), mCASP-7 (Mch3), mCASP-11 (TX) and mCASP-12. mCASP-11 is presumably the murine homolog of human CASP-4. Although mCASP-12 is related to human CASP-5 (ICE re i-III), it is most probably a new CASP-1 family member. On the basis of sequence homology, the caspases can be divided into three subfamilies: first, mCASP-1, mCASP-11 and mCASP-12; second, mCASP-2; third, mCASP-3, mCASP-6 and mCASP-7. The tissue distribution of the CASP-1 subfamily transcripts is more restricted than that of the CASP-3 subfamily transcripts, suggesting that the transcriptional regulation of the CASP members within one subfamily is related, but is quite different between the CASP-1 and the CASP-3 subfamilies. Transient overexpression of each of the seven CASPs induced apoptosis in mammalian cells. Only two, mCASP-1 as well as mCASP-3, were able to process precursor interleukin (IL)-lß to biologically active IL-lß. In addition, mCASP-3 is the predominant PARP-cleaving enzyme in vivo.

show abstract

“…Analysis of the human caspase-1 promoter has shown an IRF-1 binding site, which overlaps with the initiator element (33,34). The IRF-1 binding site is completely conserved in the murine caspase-1 promoter (35). There is no TATA box in the caspase-1 promoter (34).…”

mentioning

confidence: 99%

Role of p73 in Regulating Human Caspase-1 Gene Transcription Induced by Interferon-γ and Cisplatin

Jain¹,

Gupta²,

Sudhakar

et al. 2005

Journal of Biological Chemistry

View full text Add to dashboard Cite

The Structure and Complete Nucleotide Sequence of the Murine Gene Encoding Interleukin-1β Converting Enzyme (ICE)

Cited by 59 publications

References 0 publications

Acute systemic inflammation up-regulates secretory sphingomyelinase in vivo : A possible link between inflammatory cytokines and atherogenesis

Acute systemic inflammation up-regulates secretory sphingomyelinase in vivo : A possible link between inflammatory cytokines and atherogenesis

Characterization of seven murine caspase family members

Role of p73 in Regulating Human Caspase-1 Gene Transcription Induced by Interferon-γ and Cisplatin

Contact Info

Product

Resources

About