The Solution Structure of EMILIN1 Globular C1q Domain Reveals a Disordered Insertion Necessary for Interaction with the α4β1 Integrin

Abstract

The extracellular matrix protein EMILIN1 (elastin microfibril interface located protein 1) is implicated in maintaining blood pressure homeostasis via the N-terminal elastin microfibril interface domain and in trophoblast invasion of the uterine wall via the globular C1q (gC1q) domain. Here, we describe the first NMR-based homology model structure of the human 52-kDa homotrimer of the EMILIN1 gC1q domain. In contrast to all of the gC1q (crystal) structures solved to date, the 10-stranded ␤-sandwich fold of the gC1q domain is reduced to nine ␤ strands with a consequent increase in the size of the central cavity lumen. An unstructured loop, resulting from an insertion unique to EMILIN1 and EMILIN2 family members and located at the trimer apex upstream of the missing strand, specifically engages the ␣4␤1 integrin. Using both Jurkat T and EA.hy926 endothelial cells as well as site-directed mutagenesis, we demonstrate that the ability of ␣4␤1 integrins to recognize the trimeric EMILIN1 gC1q domain mainly depends on a single glutamic acid residue (Glu 933 ). Static and flow adhesion of T cells and haptotactic migration of endothelial cells on gC1q is fully dependent on this residue. Thus, EMILIN1 gC1q-␣4␤1 represents a unique ligand/receptor system, with a requirement for a 3-fold arrangement of the interaction site.EMILIN1 (elastin microfibril interface located protein 1) is a secreted extracellular matrix multidomain glycoprotein (1, 2). It is characterized by a unique arrangement of structural domains, including the elastin microfibril interface domain at the N terminus, an ␣-helical domain predicted to form a coiledcoil structure in the central part of the molecule, a short collagenous sequence, and a region homologous to the globular domain of C1q (gC1q domain) 4 at the C-terminal end (3, 4). Although the role of the coiled-coil region has not yet been elucidated, it has conclusively been demonstrated that EMILIN1 interacts with pro-tumor growth factor-␤ (5) through the elastin microfibril interface domain (6). EMILIN1 deficiency causes systemic arterial hypertension, and the expression of EMILIN1 at physiological levels by binding to pro-tumor growth factor-␤ prevents its maturation by protein convertases (5). Thus, EMILIN1 favorably located at the subendothelium of blood vessels is a new specific antagonist of tumor growth factor-␤, and the function of this constituent of elastic tissues is linked to the pathogenesis of hypertension. The C-terminal gC1q domain is involved in the oligomerization of EMILIN1 (7), in cell adhesion and migration via interaction with the ␣4␤1 integrin (8), and in trophoblast invasion (9).The gC1q signature is found in a variety of proteins, and the essential features of the specific structure-function relationship were recognized with the elucidation of the crystal structure of the homotrimeric gC1q domain of mouse ACRP30 (adipocyte complement-related protein of 30 kDa) (10). It suggested a structural and evolutionary link between the tumor necrosis factor and the gC1q domains and le...

EMILIN1/α9β1 Integrin Interaction Is Crucial in Lymphatic Valve Formation and Maintenance

“…(F) Haptotactic movement of HMVEC-dLyNeo cells toward EMILIN1-␣9 interaction regulates LEC proliferation and migration. HMVEC-LLy and HMVEC-dLyNeo, both expressing ␣9 integrin (data not shown), were allowed to adhere to EMILIN1 or its functional adhesion gC1q domain or to a recombinant nonfunctional mutant (E933A) (18). Both lung and dermal LECs strongly adhered to EMILIN1 and gC1q (Fig.…”

“…The C-terminal domain of EMILIN1 (gC1q) and the recombinant mutant (E933A) of the integrin binding sequence of gC1q were produced as previously described (16,18). For the production of the recombinant ED-A domain (EIIIA), the 273-bp cDNA sequence coding for the complete amino acid sequence of the mouse EIIIA domain from residue 1721 to residue 1811 of mouse fibronectin (NCBI NP_034363.1) was generated by reverse transcription (RT)-PCR using as the template mouse embryo total RNA transcribed with avian myeloblastosis virus (Promega) and amplified with Phusion Taq DNA polymerase (NEB) and the following specific primers: (i) 5= CCGGATCCAACATTGATCGCCCTAAA 3=, including the underlined BamHI restriction site, and (ii) 5= GGGGTACCTTAGGCTGTGGACTG GATTCCAATC 3=, including the underlined KpnI restriction site.…”

Neutrophil elastase cleavage of the gC1q domain impairs the EMILIN1-α4β1 integrin interaction, cell adhesion and anti-proliferative activity

“…It is involved via the EMI domain in the maintenance of blood vascular cell morphology and function14; in addition, EMILIN1 promotes adhesion and migration1516 and controls cell proliferation1317 through its gC1q domain. So far, among the gC1q domains of several other ECM components, EMILIN1 gC1q is the only one capable of interacting with the α4β1 integrin15161718, which is predominantly expressed on the surface of hemopoietic cells, working as a receptor to allow adhesion to blood vessel wall19 or extracellular matrix constituents20. The interaction between α4β1 and EMILIN1 gC1q is particularly efficient because even very low ligand concentrations provide very strong adhesion and migration1516.…”

An EMILIN1-Negative Microenvironment Promotes Tumor Cell Proliferation and Lymph Node Invasion

“…EMILIN1 (Elastic Microfibril Interface Located proteIN) is associated with elastic fibers (29) and besides being expressed in lymphatic capillaries, it is particularly abundant in the walls of large blood vessels (30), intestine, lung, lymph nodes, and skin (28). EMILIN1 interacts with the a4b1 integrin through its gC1q domain, and it has strong adhesive and migratory properties for different cell types (31)(32)(33). Emilin1 À/À mice display dermal and epidermal hyperproliferation because of the lack of EMILIN1 engagement by a4b1 or a9b1 integrins and the consequent upregulation of pErk1/2 levels through PTEN (34).…”