The SHP2‐ERK2 signaling pathway regulates branched I antigen formation by controlling the binding of CCAAT/enhancer binding protein α to the <i>IGnTC</i> promoter region during erythroid differentiation

Liao, Yi Jen; Lee, Yen-Hua; Chang, Fu Ling; Ho, Hsun; Huang, Chin Han; Twu, Yuh Ching

doi:10.1111/trf.13796

Cited by 7 publications

(8 citation statements)

References 52 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…RNA isolation and first‐strand cDNA synthesis were prepared as previously described . The full length IGnTA cDNA was obtained by polymerase chain reaction (PCR) with the primer pairs (ATCGGCT AGCGCAATGGCTATGGGCTCTTGGAAGCACTGTCT and ATCGGATATCTCAATGG GATGGTGATGATGAAAATACCAGCTGGGTTGTATCGC).…”

Section: Methodsmentioning

confidence: 99%

Branched I antigens on leukemia cells enhanced sensitivity against natural killer–cell cytotoxicity through affecting the target–effector interaction

Lee

Liao²,

Huang³

et al. 2017

Transfusion

Self Cite

View full text Add to dashboard Cite

show abstract

Section: Methodsmentioning

confidence: 99%

Branched I antigens on leukemia cells enhanced sensitivity against natural killer–cell cytotoxicity through affecting the target–effector interaction

Lee

Liao²,

Huang³

et al. 2017

Transfusion

Self Cite

View full text Add to dashboard Cite

show abstract

“…46,[51][52][53] Specifically, dephosphorylation of Ser21 is associated with enhanced binding of C/EBPa to the GCNT2C promoter, while phosphorylation diminishes the ability of C/EBPa to induce GCNT2C expression and I-antigen formation. 52,53 SHP-2 and ERK-2 have been identified to function in concert as negative regulators of this process, where ERK-2 works upstream of C/ EBPa to regulate its Ser21 phosphorylation, and SHP-2 works upstream of ERK-2 to regulate both ERK-2 and C/EBPa phosphorylation (Figure 2c). 53 The malignancy-associated transforming growth factor-b (TGF-b)/SMAD pathway is also of interest, enhancing GCNT2 transcription in breast cancer studies via activation of cofactor pSMAD2 (Figure 2d).…”

Section: Transcriptional Regulationmentioning

confidence: 99%

Melanoma‐associated glycosyltransferase GCNT2 as an emerging biomarker and therapeutic target*

et al. 2021

View full text Add to dashboard Cite

Summary In metastatic melanoma, with a dismal survival rate and propensity for treatment resistance and recurrence, it is critical to establish biomarkers that better predict treatment response and disease severity. The melanoma glycome, composed of complex carbohydrates termed glycans, is an under‐investigated area of research, although it is gaining momentum in the cancer biomarker and therapeutics field. Novel findings suggest that glycans play a major role in influencing melanoma progression and could be exploited for prognosticating metastatic activity and/or as therapeutic targets. In this review, we discuss the role of aberrant glycosylation, particularly the specialized function of β1,6 N‐acetylglucosaminyltransferase 2 (GCNT2), in melanoma pathogenesis and summarize mechanisms of GCNT2 regulation to illuminate its potential as a predictive marker and therapeutic target.

show abstract

“…Nuclear proteins and cytosol proteins were prepared using NE‐PER nuclear and cytoplasmic extraction reagent (Thermo Fisher Scientific) according to the manufacturer's instructions. Total protein extraction and Western blotting were performed as previously described 36 . The antibodies used in this study were anti‐FoxO1, anti‐DNMT3A from Cell Signaling, anti‐DNMT1, anti‐GAPDH from Thermo Fisher Scientific and anti‐LaminA from Sigma‐Aldrich, and anti‐DNMT3B from Novus Biologicals (Centennial, CO).…”

Section: Methodsmentioning

confidence: 99%

DNA methylation‐mediated Siglec‐7 regulation in natural killer cells via two 5′ promoter CpG sites

Huang¹,

Chiou

et al. 2020

Immunology

View full text Add to dashboard Cite

First discovered on the natural killer (NK) cell, the cell surface inhibitory receptor sialic acid-binding immunoglobulin-like lectin-7 (Siglec-7) is known for regulating many important biological activities. However, the detail regulatory mechanism for Siglec-7 expression in NK cells currently remains unclear. In this study, we aimed to investigate how cell surface Siglec-7 expression is regulated and found that, in both NK cell lines and peripheral NK cells, transcription was the main regulatory step. Furthermore, when NK-92MI and peripheral NK cells were treated with DNA methyltransferase (DNMT) inhibitor, the CpG island, with 9 CpG sites, in 5′ Siglec-7 promoter became noticeably hypomethylated, and Siglec-7 expression increased in both RNA transcript and surface protein. Within this CpG island, we identified both CpG 8 and CpG 9 as two key regulators responsible for Siglec-7 expression. Additionally, by using histone deacetylases (HDAC) inhibitor, butyric acid, we showed that Siglec-7 expression was also subjected to the histone modification. And a combined treatment with both 5-azacytidine and butyric acid showed an additive effect on Siglec-7 transcript expression in peripheral NK cells.

show abstract

The SHP2‐ERK2 signaling pathway regulates branched I antigen formation by controlling the binding of CCAAT/enhancer binding protein α to the IGnTC promoter region during erythroid differentiation

Abstract: SHP2-ERK2 signaling acts upstream of C/EBPα as a regulator of cell surface I antigen synthesis. Such regulation is specific for RBC but not for granulocyte differentiation.

Cited by 7 publications

References 52 publications

Branched I antigens on leukemia cells enhanced sensitivity against natural killer–cell cytotoxicity through affecting the target–effector interaction

Branched I antigens on leukemia cells enhanced sensitivity against natural killer–cell cytotoxicity through affecting the target–effector interaction

Melanoma‐associated glycosyltransferase GCNT2 as an emerging biomarker and therapeutic target*

DNA methylation‐mediated Siglec‐7 regulation in natural killer cells via two 5′ promoter CpG sites

Contact Info

Product

Resources

About