The Sequence of theOrgyia pseudotsugataMultinucleocapsid Nuclear Polyhedrosis Virus Genome

Ahrens, Christian H.; Russell, Rebecca L. Q.; Funk, C. Joel; Evans, John K.; Harwood, S.H.; Rohrmann, George F.

doi:10.1006/viro.1997.8448

Cited by 258 publications

(165 citation statements)

References 84 publications

Supporting

Mentioning

151

Contrasting

Unclassified

Order By: Relevance

“…This is similar to the 24/30 matches for the BmNPV (Gomi et al, 1999) and OpMNPV (Ahrens et al, 1997) palindrome sequence, and the 26/30 matches for the AcMNPV (Ayres et al, 1994) palindrome consensus (Fig. 3a).…”

Section: Sequence Analysis Of Mavinpv Genomesupporting

confidence: 80%

“…3b). A similar arrangement of hrs is also found in the OpMNPV genome (Ahrens et al, 1997). The MaviNPV hr palindrome consensus GTTTTACGAGTAGAATCGTACTCGTAAAGC shows 24/30 palindrome matches ( Supplementary Fig.…”

Section: Sequence Analysis Of Mavinpv Genomesupporting

confidence: 66%

“…Homologues of AcMNPV ORF83 also flank hr3 on the left in BmNPV (ORF69), OpMNPV (ORF86) and MaviNPV (ORF66). Similarly, BmNPV lacks homologues to AcMNPV ORFs 84-86, and hr3 is therefore flanked by the BmNPV ORF70, which is an AcMNPV ORF87 homologue (Ahrens et al, 1997). In contrast, MaviNPV lacks a large region comparable to AcMNPV ORFs 84-88 and therefore MaviNPV hr3 is flanked on the right by ORF67, an AcMNPV ORF89 homologue.…”

Section: Sequence Analysis Of Mavinpv Genomementioning

confidence: 99%

See 2 more Smart Citations

Genomic and host range studies of Maruca vitrata nucleopolyhedrovirus

Chen

Lee

et al. 2008

Journal of General Virology

View full text Add to dashboard Cite

The complete genome of the Maruca vitrata nucleopolyhedrovirus (MaviNPV) isolated from the legume pod borer, Maruca vitrata (Lepidoptera: Pyralidae), was sequenced. It was found to be 111 953 bp in length, with an overall 39 % G+C content, and contained 126 open reading frames (ORFs) encoding predicted proteins of over 50 aa. The gene content and gene order of MaviNPV have the highest similarity to those of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and their shared homologous genes are 100 % collinear. In fact, MaviNPV seems to be a mini-AcMNPV that is native to Taiwan and possesses a smaller genome with fewer auxiliary genes than the AcMNPV type species. Except for one ORF (Mv74), all of the MaviNPV ORFs have homologues in the AcMNPV genome. MaviNPV is the first lepidopteranspecific baculovirus to lack homologues of vfgf and odv-e66. In addition, MaviNPV lacks the baculovirus repeat ORF (bro) gene that corresponds to AcMNPV ORF2. Five homologous regions (hrs) were located within the MaviNPV genome, and these contained a total of 44 imperfect palindromes. Phylogenetic analysis of the whole genome revealed that MaviNPV was separated from the common ancestor of AcMNPV and Bombyx mori nucleopolyhedrovirus before these two viral species diverged from each other. Moreover, replication of MaviNPV in several cell lines and an egfp-MaviNPV infection assay revealed that IPLB-LD-652Y cells are only partially permissive to MaviNPV, which supports our conclusion that MaviNPV is a distinct species of the group I lepidopteran NPVs.

show abstract

Section: Sequence Analysis Of Mavinpv Genomesupporting

confidence: 80%

Section: Sequence Analysis Of Mavinpv Genomesupporting

confidence: 66%

Section: Sequence Analysis Of Mavinpv Genomementioning

confidence: 99%

See 1 more Smart Citation

Genomic and host range studies of Maruca vitrata nucleopolyhedrovirus

Chen

Lee

et al. 2008

Journal of General Virology

View full text Add to dashboard Cite

show abstract

“…In line with all other sequenced group II NPVs (and GVs), AdorNPV does not encode the envelope glycoprotein gp64, the major envelope fusion protein of AcMNPV, Bombyx mori MNPV (BmNPV) (Gomi et al, 1999), Orgyia pseudotsugata (Ahrens et al, 1997) and Epiphyas postvittana NPV (EppoNPV) (Monsma et al, 1996;Hyink et al, 2002). This protein appears to be unique to group I NPVs (Pearson et al, 2000;IJkel et al, 2000).…”

Section: Adornpv Structural Genesmentioning

confidence: 84%

Genomic sequence and biological characterization of a nucleopolyhedrovirus isolated from the summer fruit tortrix, Adoxophyes orana

Hilton

Winstanley

2008

Journal of General Virology

View full text Add to dashboard Cite

Adoxophyes orana nucleopolyhedrovirus (AdorNPV) was isolated from overwintering larvae from an orchard in the UK. The nucleotide sequence of the AdorNPV DNA genome was determined and analysed. The genome contains 111724 bp and has a G+C content of 35.0 mol%. The analysis predicted 121 ORFs of 150 nt or larger. Of these putative genes, 118 were homologous to genes identified previously in the Adoxophyes honmai nucleopolyhedrovirus (AdhoNPV) genome (83.3-100 % aa identity), and three AdorNPV ORFs were unique. There were four small homologous regions that consisted of a similar core sequence and at the same relative positions in the genome as AdhoNPV, but they differed in the number of repeats and orientation. Some genes that have been reported to have major roles in baculovirus biology were either absent or truncated in the AdorNPV genome. These included chitinase, which is involved in the liquefaction of the host, and the C-terminal of the ecdysteroid UDP-glucosyltransferase (egt) protein, which was truncated by 149 aa compared with AdhoNPV, with essential amino acids absent. The AdorNPV genome encoded two inhibitor of apoptosis (iap) genes compared with three in AdhoNPV and three bro genes compared with four in AdhoNPV. The susceptibility of A. orana larvae to AdorNPV was evaluated in laboratory bioassays using inoculation by microdroplet feeding and applied dose assays. LD 50 for neonates was 56 occlusion bodies rising to 2.3¾10 4 for fifth instar larvae. Median survival time values using an LD 80 dose were 8.8 days for neonates and 7.0 days for fifth instar larvae. INTRODUCTIONThe family Baculoviridae consists of invertebrate viruses with large circular, covalently closed, double-stranded DNA genomes with enveloped nucleocapsids and an occluded form of the virus embedded in proteinaceous occlusion bodies (OBs) . There are two genera of baculovirus, the Nucleopolyhedrovirus (NPV) and the Granulovirus (GV) based on OB morphology . The NPVs are further classed into group I and II NPVs (Bulach et al., 1999;Zanotto et al., 1993). The majority of the sequenced NPVs infect insects of the Lepidopteran order, but NPVs that infect dipteran or hymenopteran insect species like the mosquito-infecting Culex nigripalpus NPV, or the NPVs from three Neodiprion species, have been sequenced (Afonso et al., 2001;Garcia-Maruniak et al., 2004;Lauzon et al., 2004; Duffy et al., 2006). Baculoviruses are used worldwide as biological control agents of agricultural and forest pests. The summer fruit tortrix moth (Adoxophyes orana) is a pest of apples and pears in most of Europe and Japan.During the past 25 years, there has been increased interest in the use of a naturally occurring GV as a control agent for the summer fruit tortrix (Cross et al., 1999). Recently, a mixture of baculoviruses was recovered from larvae in the UK (Hilton & Winstanley, 2008). These were separated and found to comprise an NPV and a GV. The GV (Adoxophyes orana GV) has been characterized and completely sequenced (Wormleaton et al., 2003;Hilton & Winstanley, 2...

show abstract

“…In competition studies in which larvae were fed various combinations of the two viruses, OpMNPV out competed OpSNPV and most of the insects appeared to be exclusively infected with OpMNPV with the remainder predominately containing mixtures of both viruses [8]. Since the viruses differ significantly in gene content and diversity being members of Group I (OpMNPV) [15] and Group II (OpSNPV) [16], it is not possible to attribute these differences specifically to the MNPV or SNPV morphotype. Similar comparisons have also been reported on Heliothis zea SNPV (HzSNPV and AcMNPV) [17].…”

Section: Nucleocapsid Aggregation: Multiple Versus Single Nucleocapsimentioning

confidence: 99%

Baculovirus nucleocapsid aggregation (MNPV vs SNPV): an evolutionary strategy, or a product of replication conditions?

Rohrmann

2014

Virus Genes

View full text Add to dashboard Cite

Lepidopteran nucleopolyhedroviruses are members of the Baculoviridae and have been categorized as having two morphotypes of occluded virions: multiple nucleocapsids or single nucleocapsids within the virion envelope. Although it is a definitive characteristic of specific viruses, it appears to lack a defined genetic basis and is independent of virus phylogeny. This review summarizes the factors that appear to influence this trait and the role that it may play in virus biology.

show abstract

The Sequence of theOrgyia pseudotsugataMultinucleocapsid Nuclear Polyhedrosis Virus Genome

Cited by 258 publications

References 84 publications

Genomic and host range studies of Maruca vitrata nucleopolyhedrovirus

Genomic and host range studies of Maruca vitrata nucleopolyhedrovirus

Genomic sequence and biological characterization of a nucleopolyhedrovirus isolated from the summer fruit tortrix, Adoxophyes orana

Baculovirus nucleocapsid aggregation (MNPV vs SNPV): an evolutionary strategy, or a product of replication conditions?

Contact Info

Product

Resources

About