The Selection of Reliable Reference Genes for RT-qPCR Analysis of Anisakis simplex Sensu Stricto Gene Expression from Different Developmental Stages

Abstract

Background Anisakis simplex s. s. is a parasitic nematode with a complex life cycle in which humans can become accidental hosts by consuming raw or not fully cooked fish containing L3 larvae. The growing popularity of raw fish dishes has contributed to an increase in the incidence of anisakiasis, which has spurred scientific efforts to develop new methods for diagnosing and treating the disease and also to investigate the gene expression at different developmental stages of this parasite. The identification of reference genes suitable for the normalization of RT-qPCR data has not been studied with respect to A. simplex s. s. Methods In the present study, eight candidate reference genes were analyzed in A. simplex s. s. at two different developmental stages: L3 and L4. The expression stability of these genes was assessed by geNorm and NormFinder softwares. Results In general, our results identified translation elongation factor 1 α ( ef-1α ) and peptidyl-prolyl isomerase 12 ( ppi12) as the most stable genes in L3 and L4 developmental stages of A. simplex s. s. Validation of the selected reference genes was performed by profiling the expression of the nuclear hormone receptor gene ( nhr 48 ) in different developmental stages. Conclusions This first analysis selecting suitable reference genes for RT-qPCR in A. simplex s. s. will facilitate future functional analyses and deep mining of genetic resources in this parasitic nematode. Electronic Supplementary Material The online version of this article (10.2478/s11686-020-00220-3) contains supplementary material, which is available to authorized users.

A Complex Proteomic Response of the Parasitic Nematode Anisakis simplex s.s. to Escherichia coli Lipopolysaccharide

“…The primers for the gdf 11 were designed using the Primer3Plus software ( 42 ) (ELIXIR) based on the sequence deposited in GenBank (MF069104.1) and listed in supplemental Table S1 . The actin was used as the endogenous reference gene ( 43 ). The reaction was performed as described before ( 36 ).…”

Comparative Proteomics Analysis of Anisakis simplex s.s.—Evaluation of the Response of Invasive Larvae to Ivermectin

“…The primers for the chosen genes were designed using the Primer 5.0 software and listed in Table S1 . The elongation factor 1-alpha ( ef1-α ) gene was used as the endogenous reference gene [ 39 ]. The total RNA of larvae was isolated using a Total RNA Mini Kit (A & A Biotechnology, Gdynia, Poland).…”

Correlation of NHR-48 Transcriptional Modulator Expression with Selected CYP Genes’ Expression during Thiabendazole Treatment of Anisakis simplex (s.l.)?—An In Vitro Study

“…The specificity of the reactions was determined by analyzing the melting curves. Relative expression results were normalized with two Anisakis reference genes, elongation factor 1-alpha ( ef-1α , GenBank KP326558; F: TCCTCAAGCGTTGTTATCTGTT; R: AGTTTTGCCACTAGCGGTTCC) and peptidyprolyl-cis-trans isomerase 12 ( ppi12 , GenBank KM496568; F: GGCACGATATTCCACAGGAT; R: CTCCATAGATCGATGCACCA) [ 56 ], to the control and analyzed by the 2 −ΔΔCt method [ 57 ].…”