The Roles of DNA Polymerases κ and ι in the Error-free Bypass of N2-Carboxyalkyl-2′-deoxyguanosine Lesions in Mammalian Cells

Abstract

To counteract the deleterious effects of DNA damage, cells are equipped with specialized polymerases to bypass DNA lesions. Previous biochemical studies revealed that DinB family DNA polymerases, including Escherichia coli DNA polymerase IV and human DNA polymerase , efficiently incorporate the correct nucleotide opposite some N DNA is susceptible to damage by endogenous and exogenous agents (1). To minimize cell death arising from replication blockage and mutations emanating from nucleotide misincorporation opposite the damage site, cells are equipped with several pathways to repair DNA lesions (2). Additionally, cells have evolved two major mechanisms to tolerate unrepaired DNA lesions (3), including homologous recombination and translesion synthesis (TLS) 2 (3). In this regard, synthesis past many DNA lesions requires the replacement of replicative DNA polymerases with one or a few specialized polymerases, most of which belong to the Y-family (4). Along this line, phylogenetic analysis revealed five branches of Y-family polymerases, which include UmuC, DinB, polymerase , polymerase , and REV1 (4, 5). All of these, except for UmuC, are found in eukaryotic cells (4,5). Apart from the Y-family DNA polymerases, some B-family DNA polymerases also participate in TLS. These include DNA polymerase II in Escherichia coli and polymerase , which is composed of the catalytic subunit REV3 and the regulatory subunit REV7, in eukaryotic cells (4, 5). These specialized DNA polymerases are characterized by their relatively low fidelity in replicating undamaged DNA but have the capability to bypass those DNA lesions that normally block DNA synthesis by replicative DNA polymerases (4). It was advocated that specialized DNA polymerases are evolved by nature to copy DNA base damage accurately, but they no longer bear the ability to replicate unmodified DNA with high fidelity (6). The best known example of this is the efficient and accurate bypass of cis,syn-cyclobutane pyrimidine dimers by polymerase (7,8), which is encoded by the xeroderma pigmentosum-variant gene (i.e. POLH) in humans (9). Xeroderma pigmentosum-variant patients exhibit elevated susceptibility to developing skin cancer (10). Several recent studies also demonstrated that DinB DNA polymerase, a Y-family polymerase conserved in all three kingdoms of life (11), can insert the correct dCMP opposite several N 2 -substituted guanine lesions at an efficiency that is similar to or better than opposite an unmodified guanine (12)(13)(14). The x-ray crystal structure of the catalytic core of human DNA polymerase , along with primer/template DNA and an incoming nucleotide, reveals the lack of steric hindrance in the minor groove at the primer-template junction (15), which may account for the tolerance of polymerase toward the minor groove N 2 -dG lesions. By using shuttle vector technology, we also showed that DinB (i.e. polymerase IV) is the major polymerase involved in the accurate bypass of the two diastereomers of N 2 -(1-carboxyethyl)-2Ј-deoxyguanosine (N 2 -CEdG) in ...

A combined proteomic and targeted analysis unravels new toxic mechanisms for zinc oxide nanoparticles in macrophages

“…This may correlate, at least in part, with the lower amount of methylglyoxal-modified guanine found in the case of exposure to zinc oxide in comparison with exposure to the equivalent concentration of zinc ion. Furthermore, it must be kept in mind that methylglyoxal lesions are overcome by specialized polymerases [84]. However, these specialized polymerases introduce errors at other places in the DNA, so that zinc induces an overall burden of the DNA repair system at large.…”

A selective USP1–UAF1 inhibitor links deubiquitination to DNA damage responses

“…All other enzymes, unless otherwise specified, were purchased from New England BioLabs. We first constructed a parent vector for CPD by modifying the sequence of the original pTGFP-Hha10 plasmid, which contains an SV40 origin and is able to replicate in the SV40-transformed mammalian cells 52,53 . To this end, a 50-mer ODN with the sequence 5′AATTCGCAGCGAGTCATCCATGGCTTGGTATGAAGGAGTCGATGCATCCG-3′ was annealed with its complementary strand and ligated to an NheI-EcoRI restriction fragment from the pTGFP-Hha10 plasmid.…”

“…We next constructed the CPD-bearing double-stranded shuttle vector using a previously described method (Supplementary Fig. 10a) 52,53 . Briefly, we nicked the parent vector with Nt.BstNBI to produce a gapped vector by removing a 25-mer single-stranded ODN, which was followed by filling the gap with a 12-mer CPD-bearing ODN (5′-ATGGCXXGCTAT-3′, XX = CPD), a 13-mer unmodified ODN (5′GAAGGAGTCGATG-3′) and T4-DNA ligase.…”

Mass Spectrometry-Based Quantitative Strategies for Assessing the Biological Consequences and Repair of DNA Adducts

“…10,15,27,28 One challenging step in this experimental system is the construction of double-stranded vectors containing site-specifically inserted DNA lesions. However, the use of gapped vector-based strategy enables the facile preparation of site-specifically modified plasmids.…”