The Role of the RhoA/ROCK Signaling Pathway in Mechanical Strain-Induced Scleral Myofibroblast Differentiation

Yuan, Ying; Li, Min; To, Chi Ho; Lam, Thomas Chuen; Wang, Peng; Yu, Yunjie; Chen, Qingzhong; Hu, Xiaojun; Ke, Bilian

doi:10.1167/iovs.17-23580

Cited by 37 publications

(29 citation statements)

References 60 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Refraction and axial length were determined before and after treatment. e refractive errors were examined using an automated infrared photorefractor, as previously described [33]. e axial lengths were measured by A-ultrasonic scanning (KN-1800, KangNing, China).…”

Section: Form-deprivation Myopiamentioning

confidence: 99%

“…Cells at 80% confluence were passaged by using 0.25% trypsin-EDTA (Gibco, USA). e cells were identified by vimentin detection, as previously described [33]. Fibroblasts between 3 and 5 passages were used for the experiments.…”

Section: Transmission Electron Microscopy (Tem)mentioning

confidence: 99%

“…Primers for guinea pig GRP78 (forward: CTCCGTTCAGCAAGACATCA, reverse: AGC CTCAGCAGTTTCCTTCA, 160 bp), CHOP (forward: CCT TTCTCCTTCGGGACACT, reverse: CTCTTCATTTC-CAGGGGGTAA, 120 bp), CRT (forward: CGGTGAAG-CATGAGCAGAACATTG, reverse: CGAGTCTCCGTGC ATGTCCTTC), TGF-β1 (forward: CCCAGAGTGGTTGTC CTTTG, reverse: CGGAGCGTGTTATCTTTGCT, 123 bp), COL1A1 (forward: TGGGTCCTACTGGCAAACAT, reverse: TCACCAACCTCTCCCTTGTC, 133 bp), and GAP DH (forward: TCAAGAAGGTGGTGAAGCAG, reverse: CGTCAAAAGTGGAAGAATGG, 117 bp) were synthesized by Sangon Biotech (Shanghai, China). Relative mRNA expression levels were calculated by using the 2 −ΔΔCT method from the Ct values of the respective mRNAs relative to that of GAPDH [33].…”

Section: Quantitative Real-time Reverse Transcription-polymerase Chaimentioning

confidence: 99%

“…ey were randomly divided into three groups, which was given 24 hours, 1 week, and 4 weeks of FD, respectively. One eye was randomly selected from each guinea pig and covered with a translucent diffuser to induce form-deprivation myopia (FDM), as previously described [33], while the other eye served as the untreated control.…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Endoplasmic Reticulum Stress Regulates Scleral Remodeling in a Guinea Pig Model of Form-Deprivation Myopia

Zhu

Chen

Yuan

et al. 2020

Journal of Ophthalmology

Self Cite

View full text Add to dashboard Cite

Purpose. This study aimed to investigate the role of endoplasmic reticulum (ER) stress in scleral remodeling in a guinea pig model of form-deprivation myopia (FDM). Methods. Guinea pigs were form deprived to induce myopia. ER ultrastructural changes in the sclera were examined by transmission electron microscopy (TEM). The protein levels of ER stress chaperones, including GRP78, CHOP, and calreticulin (CRT), were analyzed by western blotting at 24 hours, 1 week, and 4 weeks of FD. Scleral fibroblasts from guinea pigs were cultured and exposed to the ER stress inducer tunicamycin (TM) or the ER stress inhibitor 4-phenylbutyric acid (4-PBA). CRT was knocked down by lentivirus-mediated CRT shRNA transfection. The expression levels of GRP78, CHOP, TGF-β1, and COL1A1 were analyzed by qRT-PCR or western blotting. Results. The sclera of FDM eyes exhibited swollen and distended ER at 4 weeks, as well as significantly increased protein expression of GRP78 and CRT at 1 week and 4 weeks, compared to the sclera of the control eyes. In vitro, TM induced ER stress in scleral fibroblasts, which was suppressed by 4-PBA. The mRNA expression of TGF-β1 and COL1A1 was upregulated after TM stimulation for 24 hours, but downregulated for 48 hours. Additionally, change of TGF-β1 and COL1A1 transcription induced by TM was suppressed by CRT knockdown. Conclusions. ER stress was an important modulator which could influence the expression of the scleral collagen. CRT might be a new target for the intervention of the FDM scleral remodeling process.

show abstract

Section: Form-deprivation Myopiamentioning

confidence: 99%

Section: Transmission Electron Microscopy (Tem)mentioning

confidence: 99%

Section: Quantitative Real-time Reverse Transcription-polymerase Chaimentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Endoplasmic Reticulum Stress Regulates Scleral Remodeling in a Guinea Pig Model of Form-Deprivation Myopia

Zhu

Chen

Yuan

et al. 2020

Journal of Ophthalmology

Self Cite

View full text Add to dashboard Cite

show abstract

“…The proteoglycan-collagen matrix imbibes a large amount of fluid, making sclera ~70% water by weight [2]. Scleral fibroblasts actively maintain this proteoglycan and collagen matrix; however, a subset of these cells have also been shown to have contractile abilities, allowing them to interface with and actively influence biomechanics [9].…”

Section: Introductionmentioning

confidence: 99%

A Biphasic Approach for Characterizing Tensile, Compressive, and Hydraulic Properties of the Sclera

Brown

Pardue

Ethier

2020

Preprint

View full text Add to dashboard Cite

Measuring the biomechanical properties of the mouse sclera is of great interest, since altered scleral properties are features of many common ocular pathologies, and the mouse is a powerful species for studying genetic factors in disease. Here, a poroelastic material model is used to analyze data from unconfined compression testing of both pig and mouse sclera, and the tensile modulus, compressive modulus, and permeability of the sclera are obtained at three levels of compressive strain. Values for all three properties measured simultaneously by unconfined compression of pig sclera were comparable to previously reported values measured by tests specific for each property, i.e., compression tests, biaxial tensile tests, and falling-head permeability assays. The repeatability of the approach was evaluated using test-retest experimental paradigm on pig sclera. Repeatability was low for measured compressive stiffness, indicating permanent changes to the samples occurring after the first test. However, reasonable repeatability for tensile stiffness and permeability was observed. The intrinsic material properties of the mouse sclera were measured for the first time. Tensile stiffness and permeability of the sclera in both species were seen to be dependent on the state of compressive strain. We conclude that unconfined compression testing of sclera, when analyzed with poroelastic theory, can be used as a powerful tool to phenotype mouse scleral changes in future genotype-phenotype association studies. Statement of SignificanceOcular biomechanics is strongly influenced by the sclera, the outermost white coat of the eye. Many ocular diseases are believed to be influenced by pathological changes to scleral microstructure and biomechanics, making intrinsic biomechanical properties an important outcome measure in many studies. However, the small mouse eye precludes the use of most traditional biomechanical characterization techniques. Here, we show that unconfined compression testing analyzed with poroelastic theory can produce measurements of biomechanical properties in the pig sclera comparable to those measured by other traditional techniques. Importantly, this technique can be successfully applied to the mouse sclera, enabling more widespread use of the species as a model for ocular disease.

show abstract

In Vitro Mechanical Stimulation to Reproduce the Pathological Hallmarks of Human Cardiac Fibrosis on a Beating Chip and Predict The Efficacy of Drugs and Advanced Therapies

Visone,

Paoletti,

Cordiale

et al. 2023

Adv Healthcare Materials

View full text Add to dashboard Cite

Cardiac fibrosis is one of the main causes of heart failure, significantly contributing to mortality. The discovery and development of effective therapies able to heal fibrotic pathological symptoms thus remain of paramount importance. Micro‐physiological systems (MPS) are recently introduced as promising platforms able to accelerate this finding. Here a 3D in vitro model of human cardiac fibrosis, named uScar, is developed by imposing a cyclic mechanical stimulation to human atrial cardiac fibroblasts (AHCFs) cultured in a 3D beating heart‐on‐chip and exploited to screen drugs and advanced therapeutics. The sole provision of a cyclic 10% uniaxial strain at 1 Hz to the microtissues is sufficient to trigger fibrotic traits, inducing a consistent fibroblast‐to‐myofibroblast transition and an enhanced expression and production of extracellular matrix (ECM) proteins. Standard of care anti‐fibrotic drugs (i.e., Pirfenidone and Tranilast) are confirmed to be efficient in preventing the onset of fibrotic traits in uScar. Conversely, the mechanical stimulation applied to the microtissues limit the ability of a miRNA therapy to directly reprogram fibroblasts into cardiomyocytes (CMs), despite its proved efficacy in 2D models. Such results demonstrate the importance of incorporating in vivo‐like stimulations to generate more representative 3D in vitro models able to predict the efficacy of therapies in patients.

show abstract

The Role of the RhoA/ROCK Signaling Pathway in Mechanical Strain-Induced Scleral Myofibroblast Differentiation

Cited by 37 publications

References 60 publications

Endoplasmic Reticulum Stress Regulates Scleral Remodeling in a Guinea Pig Model of Form-Deprivation Myopia

Endoplasmic Reticulum Stress Regulates Scleral Remodeling in a Guinea Pig Model of Form-Deprivation Myopia

A Biphasic Approach for Characterizing Tensile, Compressive, and Hydraulic Properties of the Sclera

In Vitro Mechanical Stimulation to Reproduce the Pathological Hallmarks of Human Cardiac Fibrosis on a Beating Chip and Predict The Efficacy of Drugs and Advanced Therapies

Contact Info

Product

Resources

About