The Role of the Hydrophobic Domain in Orienting Natural Signal Sequences within the ER Membrane

Eusebio, Alexander; Friedberg, Thomas; Spiess, Martin

doi:10.1006/excr.1998.4042

Cited by 26 publications

(35 citation statements)

References 19 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…cDNA Constructs-The plasmids encoding H1⌬QL 16 and H1⌬QL 19 have been described previously (14). H1⌬Q derivatives with hydrophobic sequences Ala 16 , Ile 16 , Val 16 , Phe 16 , (Leu-Val) 8 , (Leu-Ala) 8 , Tyr 22 , Met 16 , and Met 22 were generated by annealing two complementary oligonucleotides encoding the sequence MGPQ and the respective hydrophobic sequences with 5Ј and 3Ј sticky ends for ligation into a KpnI and a BamHI site, respectively.…”

Section: Methodsmentioning

confidence: 99%

“…H1⌬Q derivatives with hydrophobic sequences Ala 16 , Ile 16 , Val 16 , Phe 16 , (Leu-Val) 8 , (Leu-Ala) 8 , Tyr 22 , Met 16 , and Met 22 were generated by annealing two complementary oligonucleotides encoding the sequence MGPQ and the respective hydrophobic sequences with 5Ј and 3Ј sticky ends for ligation into a KpnI and a BamHI site, respectively. For example, to construct H1⌬QV 16 , the oligonucleotides CATGGGACCGCAGGTAGTTGTCGTGGTGGTCGTA-GTTGTAGTTGTCGTGGTAGTTGTCGTGG and GATCCCACGACAA-CTACCACGACAACTACAACTACGACCACCACGACAACTACCTGC-GGTCCCATGGTAC were used. The annealed oligonucleotides were ligated into the plasmid pE-BE, digested with KpnI and BamHI.…”

Section: Methodsmentioning

confidence: 99%

“…For example, H1⌬QV 19 , H1⌬QV 22 , and H1⌬QV 25 were produced using a the mutagenic antisense oligonucleotides CGCGGATCCCAC-CACCACCACGACAACTACCACG, CGCGGATCCGACGACGACCAC-CACCACCACGACA, and CGCGGATCCTACTACAACGACGACGAC-CACCACC with the templates H1⌬QV 16 , H1⌬QV 19 , and H1⌬QV 22 , respectively. The polymerase chain reaction products were digested with KpnI and a BamHI and ligated into pE-BE.…”

Section: Methodsmentioning

confidence: 99%

“…To introduce different amino acids within the oligoleucine sequence of H1⌬QL 16 and H1⌬QL 19 for the constructs H1⌬QX 2/16 and H1⌬QX 2/19 , polymerase chain reaction was performed using an antisense oligonucleotide corresponding to the 3Ј-end of the oligoleucine sequence of H1⌬QL 16 or H1⌬QL 19 including the BamHI site and containing mutations to alter the sequence of Leu-8 and Leu-13 or the sequence of Leu-11 and Leu-16, respectively, to codons of the desired amino acid X. To introduce the amino acids in the N-terminal half of the oligoleucine sequence of H1⌬QL 19 for the constructs H1⌬QX 2/19N , polymerase chain reaction was performed using a sense oligonucleotide corresponding to the 5Ј-end of the sequence including the KpnI site and containing mutations to alter the sequence of Leu-4 and Leu-9 to the desired codons.…”

Section: Methodsmentioning

confidence: 99%

“…The influence of oligoleucine signals of different lengths on the topology was additive with the effects of flanking charges and of the N-terminal hydrophilic sequence (14). The topogenic contribution of the hydrophobic sequence was also shown to be important for natural proteins, since the correct and unique insertion of the signals of the vasopressin precursor (N cyt /C exo ) and of microsomal epoxide hydrolase (N exo /C cyt ) was compromised upon extending or shortening the apolar sequence, respectively (16).…”

mentioning

confidence: 99%

See 4 more Smart Citations

The Topogenic Contribution of Uncharged Amino Acids on Signal Sequence Orientation in the Endoplasmic Reticulum

Rösch

Naeher

Laird

et al. 2000

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

Signal sequences for insertion of proteins into the endoplasmic reticulum induce translocation of either the C-or the N-terminal sequence across the membrane. The end that is translocated is primarily determined by the flanking charges and the hydrophobic domain of the signal. To characterize the hydrophobic contribution to topogenesis, we have challenged the translocation machinery in vivo in transfected COS cells with model proteins differing exclusively in the apolar segment of the signal. Homo-oligomers of hydrophobic amino acids as different in size and shape as Val 19 , Trp 19 , and Tyr 22 generated functional signal sequences with similar topologies in the membrane. The longer a homo-oligomeric sequence of a given residue, the more N-terminal translocation was obtained. To determine the topogenic contribution of all uncharged amino acids in the context of a hydrophobic signal sequence, two residues in a generic oligoleucine signal were exchanged for all uncharged amino acids. The resulting scale resembles a hydrophobicity scale with the more hydrophobic residues promoting N-terminal translocation. In addition, the helix breakers glycine and proline showed a positiondependent effect, which raises the possibility of a conformational contribution to topogenesis.Proteins destined for the endoplasmic reticulum (ER) 1 are synthesized with a hydrophobic signal sequence of typically 10 -20 uncharged, mainly apolar amino acids. This sequence is recognized by the signal recognition particle, which targets the nascent chain-ribosome complex via the signal recognition particle receptor to the ER membrane (1). The ribosome binds to the translocon, a gated pore made of several copies of the heterotrimeric Sec61 complex (2-4). The signal sequence inserts into the translocon, specifically contacting Sec61␣, in a manner that leads to translocation of either the C terminus or the N terminus across the membrane (5). Cleaved signals of secretory and type I membrane proteins (e.g. glycophorin) and signal anchor sequences of type II membrane proteins (e.g. transferrin receptor) translocate the C-terminal sequence, whereas the reverse signal anchors of cytochrome P-450, microsomal epoxide hydrolase, and opsin, for example, translocated the N-terminal sequence. The end of the signal that is translocated is determined by several factors. Charged residues flanking the apolar segment of the signal influence the insertion process in a manner that induces the more positive end to stay on the cytoplasmic side (6, 7). However, the charge distribution is not generally sufficient to determine the orientation and to generate a unique topology (8, 9). Hydrophilic sequences N-terminal of the signal may inhibit their translocation if they fold in the cytosol before targeting is completed (10). Similarly, we have recently observed that glycosylation at sites near the signal sequence can influence topogenesis by glycan attachment to polypeptide segments that are transiently exposed to the ER lumen (11).In addition, the apolar segment of the ...

show abstract