The Role of the Carbohydrate Recognition Domain of Placental Protein 13 (PP13) in Pregnancy Evaluated with Recombinant PP13 and the DelT221 PP13 Variant

Abstract

IntroductionPlacental protein 13 (PP13), a placenta specific protein, is reduced in the first trimester of pregnancy in women who subsequently develop preeclampsia. A naturally occurring PP13 deletion of thymidine at position 221 (DelT221 or truncated variant) is associated with increased frequency of severe preeclampsia. In this study we compared the full length (wildtype) PP13 and the truncated variant.MethodsFull length PP13 or its DelT221 variant were cloned, expressed and purified from E-Coli. Both variants were administrated into pregnant rats at day 8 of pregnancy for slow release (>5 days) through osmotic pumps and rat blood pressure was measured. Animals were sacrificed at day 15 or day 21 and their utero-placental vasculature was examined.ResultsThe DelT221 variant (11 kDA) lacked exon 4 and a part of exon 3, and is short of 2 amino acids involved in the carbohydrate (CRD) binding of the wildtype (18 kDA). Unlike the wildtype PP13, purification of DelT221 variant required special refolding. PP13 specific poly- clonal antibodies recognized both PP13 and DelT221 but PP13 specific monoclonal antibodies recognized only the wildtype, indicating the loss of major epitopes. Wildtype PP13 mRNA and its respective proteins were both lower in PE patients compared to normal pregnancies. The DelT221 mutant was not found in a large Caucasian cohort. Pregnant rats exposed to wildtype or DelT221 PP13 variants had significantly lower blood pressure compared to control. The wildtype but not the DelT221 mutant caused extensive vein expansion.ConclusionThis study revealed the importance of PP13 in regulating blood pressure and expanding the utero-placental vasculature in pregnant rats. PP13 mutant lacking amino acids of the PP13 CRD domain fails to cause vein expansion but did reduce blood pressure. The study provides a basis for replenishing patients at risk for preeclampsia by the full length but not the truncated PP13.

Placental Protein 13 Administration to Pregnant Rats Lowers Blood Pressure and Augments Fetal Growth and Venous Remodeling

“…Thereafter, blood pressure returned to normal over a period of several days such that there were no differences by day 15 of gestation. Although the mutant form of PP13 is unable to bind carbohydrates [32], this does not appear to be a requisite for inducing systemic hypotension. A former study by Burger et al [22] has shown that PP13 is capable of causing the release of prostacyclin.…”

“…Unlike the hypotensive effect, which was developed regardless of the wild-type or the mutated PP13 variant, the impact on placental and pup weights was not observed in the PP13M group, suggesting that carbohydrate binding was required, or that it was related to the anticipated altered tertiary structure of PP13M compared to the normal PP13 [32]. Furthermore, pup weights in this group were reduced by >50% on average by day 21 of pregnancy in the PP13M group compared to the other 2 groups.…”

“…According to Visegrady et al [34], the carbohydrate recognition domain of PP13 consists of 8 amino acid residues, of which 4 (those on positions 53, 65, 72 and 75) form a ‘pocket' that fits the sugar residue in a ‘key and lock' manner. An additional 4 (located on positions 55, 57, 63 and 77) add to the affinity to sugar residues [32]. The DelT 221 mutant lacks only 2 amino acid residues (on positions 72 and 75) of the 8 that are involved in enabling carbohydrate binding.…”

“…The DelT 221 mutant lacks only 2 amino acid residues (on positions 72 and 75) of the 8 that are involved in enabling carbohydrate binding. However, this naturally occurring mutant molecule [29] was demonstrated by Sammar et al [32] to be so misfolded in order to completely lack the sugar-binding capacity. Therefore, very strict conformational requirements appear to exist for mediating some of the biological actions of PP13 on vascular, placental and fetal tissues.…”

“…The full length of wild-type PP13 was previously cloned in pQE-30 plasmid [23,31,32] and was used as a template to amplify the wild-type PP13 and its DelT 221 PP13 mutant (referred to as ‘truncated') sequence by PCR. Two primers were designed with the following sequences: a sense primer: CGAATCCATGTCTTCTTTACCCGTGC, and an antisense primer: TAAGTCGAGCTCCATCCATATCCCAAACTCAC.…”