The Role of Epigenetic Changes in Ovarian Cancer: A Review

Qazi, Sahar; Sharma, Ashok; Raza, Khalid

doi:10.1007/s40944-021-00505-z

Cited by 8 publications

(6 citation statements)

References 88 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Recent studies have discerned that POTEE paralog gets epigenetically regulated in many cancers including ovarian cancer [ 19 , 20 , 44 ], [ 45 ], [ 46 ]. Sharma et al.…”

Section: Resultsmentioning

confidence: 99%

“…This evidence suggests that since the majority of the network associators of POTEE are epigenetically activated in many cancers, it is quite natural for POTEE paralog to get over-expressed and epigenetically regulated in ovarian cancer too. Moreover, there exist various experimental studies [ 19 , 20 , 44 ], [ 45 ], [ 46 ], [ 47 ], [ 48 ], [ 49 ], [ 50 ], [ 51 ], [ 52 ], [ 53 ], [ 54 ] that discern its epigenetic dynamics in different diseases.…”

Section: Resultsmentioning

confidence: 99%

“…There is a lack of effective biomarkers, and thus, no person-centric treatment strategy is available. Generic information suggests that age, familial history, genetics, environmental factors are responsible for causing ovarian cancer [ 2 ].…”

Section: Introductionmentioning

confidence: 99%

“…The epigenetic modifications consist of mutualistic interactions between DNA methylation, histone modification, and micro RNA (miRNA) expression that channelize and maintain the gene expression during cancer formation [ 14 ]. Myriad epigenetic mechanisms have also been observed to trigger the development of ovarian cancer [ 2 ]. Prostate ovary testis embryo expression (POTE), a cancer testis antigen (CTA) family of 14 paralogs have been classified according to phylogenetic evidences into three main groups – group I (POTEA), group II (POTEB1, B2, B3, C & D) and group III (POTE, F, I, J, KP, M) [ 15 – 18 ].…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

In silico approach to understand epigenetics of POTEE in ovarian cancer

Qazi

Raza

2021

Journal of Integrative Bioinformatics

Self Cite

View full text Add to dashboard Cite

Ovarian cancer is the third leading cause of cancer-related deaths in India. Epigenetics mechanisms seemingly plays an important role in ovarian cancer. This paper highlights the crucial epigenetic changes that occur in POTEE that get hypomethylated in ovarian cancer. We utilized the POTEE paralog mRNA sequence to identify major motifs and also performed its enrichment analysis. We identified 6 motifs of varying lengths, out of which only three motifs, including CTTCCAGCAGATGTGGATCA, GGAACTGCC, and CGCCACATGCAGGC were most likely to be present in the nucleotide sequence of POTEE. By enrichment and occurrences identification analyses, we rectified the best match motif as CTTCCAGCAGATGT. Since there is no experimentally verified structure of POTEE paralog, thus, we predicted the POTEE structure using an automated workflow for template-based modeling using the power of a deep neural network. Additionally, to validate our predicted model we used AlphaFold predicted POTEE structure and observed that the residual stretch starting from 237-958 had a very high confidence per residue. Furthermore, POTEE predicted model stability was evaluated using replica exchange molecular dynamic simulation for 50 ns. Our network-based epigenetic analysis discerns only 10 highly significant, direct, and physical associators of POTEE. Our finding aims to provide new insights about the POTEE paralog.

show abstract

“…Recent studies have discerned that POTEE paralog gets epigenetically regulated in many cancers including ovarian cancer [ 19 , 20 , 44 ], [ 45 ], [ 46 ]. Sharma et al.…”

Section: Resultsmentioning

confidence: 99%

Section: Resultsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

In silico approach to understand epigenetics of POTEE in ovarian cancer

Qazi

Raza

2021

Journal of Integrative Bioinformatics

Self Cite

View full text Add to dashboard Cite

show abstract

“…The role of epigenetics in diagnosis of ovarian cancer is of paramount importance. Many gene hypermethylation changes have been reported [ 22 , 40 ]. Identified DNA methylation markers serve as a potential for early diagnosis by investigating for their presence in cell-free DNA (cf-DNA) in serum [ 37 , 41 – 43 ].…”

Section: Discussionmentioning

confidence: 99%

PCDH17 gene promoter methylation status in a cohort of Egyptian women with epithelial ovarian cancer

et al. 2023

View full text Add to dashboard Cite

Background and objective Ovarian cancer is a leading cause of female mortality. Epigenetic changes occur in early stages of carcinogenesis and represent a marker for cancer diagnosis. Protocadherin 17 (PCDH17) is a tumor suppressor gene involved in cell adhesion and apoptosis. The methylation of PCDH17 gene promoter has been described in several cancers including ovarian cancer. The aim of the study was to compare the methylation status of PCDH17 gene promoter between females diagnosed with epithelial ovarian cancer and a control group composed of normal and benign ovarian lesions. Methods Fifty female subjects were included in our study (25 ovarian cancer patients and 25 controls). DNA was extracted from Formalin-Fixed Paraffin-Embedded (FFPE) tissues of the subjects. Methylation levels for six CpG sites in the PCDH17 gene promoter were assessed by pyrosequencing. Results The methylation levels at five out of six sites were significantly higher in females with epithelial ovarian cancer compared to the control group. Moreover, the same applies for the mean methylation level with p value 0.018. Conclusion Methylation of PCDH17 gene promoter plays a role in ovarian carcinogenesis and can be used for diagnosis and early detection.

show abstract

Integrative Analysis of Ovarian Serious Adenocarcinoma to Understand Disease Network Biology

Qazi

Raza

2022

Bioinformatics and Biomedical Engineering

View full text Add to dashboard Cite

The Role of Epigenetic Changes in Ovarian Cancer: A Review

Cited by 8 publications

References 88 publications

In silico approach to understand epigenetics of POTEE in ovarian cancer

In silico approach to understand epigenetics of POTEE in ovarian cancer

PCDH17 gene promoter methylation status in a cohort of Egyptian women with epithelial ovarian cancer

Integrative Analysis of Ovarian Serious Adenocarcinoma to Understand Disease Network Biology

Contact Info

Product

Resources

About