The resistance of cowpea seeds to bruchid beetles is not related to levels of cysteine proteinase inhibitors

Abstract

A cDNA encoding a cysteine proteinase inhibitor was isolated from a cDNA library prepared from developing seeds of an insect-resistant line of cowpea. The sequence of the encoded protein was homologous with those of other plant cysteine endoproteinase inhibitors, and with Type 2 cystatins from animals. Southern blot analyses indicated that small gene families were present in both resistant and susceptible lines of cowpea, while northern blot analyses showed similar levels of expression. It is concluded that the levels of expression of the inhibitor do not account for the differences in insect resistance of the two lines.

Fragments of ATP synthase mediate plant perception of insect attack

“…Total RNA was isolated from control and treated cowpea leaves (500 ng) and used to synthesize cDNA by using the SuperScript II First-Strand Synthesis Kit (Invitrogen) (35). First-strand reactions, run in triplicate, were subjected to quantitative PCR with primers TTGAGATCGATAGTTTAGCTCGC and TAAGTACAC-TATGCAGGTGCATC designed from cowpea cystatin (36). All reactions were done in triplicate.…”

Differential Expression of Soybean Cysteine Proteinase Inhibitor Genes during Development and in Response to Wounding and Methyl Jasmonate

“…In overall sequence, Rl is 67% identical with the peptide encoded by pLl (LI), and LI and Rl are 61 and 64%, respectively, identical with the peptide encoded by pN2 (N2). The soybean CysPIs have high sequence similarity with other plant CysPIs, including LI, which is 88% identical to the cowpea CysPI protein (Fernandes et al, 1993). All three proteins include the QxVxG motif and the W in the appropriate sequence topology to be contained in the first-and second-hairpin loop domains, respectively, that interact with Cys proteinases ( Fig.…”

“…Figure 1. Alignment of amino acid sequences deduced from pR1 (Rl), pL1 ( L I ), and pN2 (N2), with the N-terminal sequence of the soybean seed CysPI, Gm (Brzin et al, 1990) and amino acid sequences deduced from cowpea, Vu (Fernandes et al, 1993 (Bode et al, 1988;Stubbs et al, 1990;Turk and Bode, 1991) are designated by A and B, respectively. The asterisk identifies the only residue that differs between R1 and the N-terminal sequence of the soybean seed protein (Brzin et al, 1990).…”

“…Proteinaceous CysPIs are widely distributed in plants and have been isolated from a number of sources (Ryan, 1981(Ryan, , 1990, including rice (Abe et al, 1987a), cowpea (Fernandes et al, 1993), maize (Abe et al, 1992), and soybean (Glycine max L. Merr.…”

“…Vol. 112, 1996 Although it is known that plant CysPIs are encoded by gene families (Abe et al, 1987a;Kondo et al, 1990;Fernandes et al, 1993;Waldron et al, 1993;Walsh and Strickland, 1993), little is known about the differential regulation of these genes. Wounding and exogenous application of M-JA or ABA induced accumulation of an mRNA in potato leaves that has sequence homology to plant CysPI genes (Hildmann et al, 1992).…”