The regulation of sequence specific NF-κB DNA binding and transcription by IKKβ phosphorylation of NF-κB p50 at serine 80

Smith, Emma; Somma, Domenico; Kerrigan, David; McIntyre, Zoe; Cole, John; Liang, Kai Ling; Kiely, Patrick A.; Keeshan, Karen; Carmody, Ruaidhrı́ J.

doi:10.1093/nar/gkz873

Cited by 20 publications

(13 citation statements)

References 43 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…However, several studies report that SMAD1 interacts with NF-κB1 in overexpression experiments in 293 T cells, and that SMAD1 bound selectively to endogenous NF-κB1 p50 protein in RAW 264.7 cells [ 42 ]. Consistent with these observation, it has been reported that the NF-κB1 p50 homodimer can regulate specific gene expression [ 43 – 45 ]. In our current study of MM, we found that SMAD1 expression is reduced after NF-κB1 knockdown, and vice versa, suggesting that SMAD1 may contribute to MM progression by activation of NF-κB1.…”

Section: Discussionsupporting

confidence: 74%

SMAD1 as a biomarker and potential therapeutic target in drug-resistant multiple myeloma

Zhang

Faruq

et al. 2021

Biomark Res

View full text Add to dashboard Cite

Background SMAD1, a central mediator in TGF-β signaling, is involved in a broad range of biological activities including cell growth, apoptosis, development and immune response, and is implicated in diverse type of malignancies. Whether SMAD1 plays an important role in multiple myeloma (MM) pathogenesis and can serve as a therapeutic target are largely unknown. Methods Myeloma cell lines and primary MM samples were used. Cell culture, cytotoxicity and apoptosis assay, siRNA transfection, Western blot, RT-PCR, Soft-agar colony formation, and migration assay, Chromatin immunoprecipitation (Chip), animal xenograft model studies and statistical analysis were applied in this study. Results We demonstrate that SMAD1 is highly expressed in myeloma cells of MM patients with advanced stages or relapsed disease, and is associated with significantly shorter progression-free and overall survivals. Mechanistically, we show that SMAD1 is required for TGFβ-mediated proliferation in MM via an ID1/p21/p27 pathway. TGF-β also enhanced TNFα-Induced protein 8 (TNFAIP8) expression and inhibited apoptosis through SMAD1-mediated induction of NF-κB1. Accordingly, depletion of SMAD1 led to downregulation of NF-κB1 and TNFAIP8, resulting in caspase-8-induced apoptosis. In turn, inhibition of NF-κB1 suppressed SMAD1 and ID1 expression uncovering an autoregulatory loop. Dorsomorphin (DM), a SMAD1 inhibitor, exerted a dose-dependent cytotoxic effect on drug-resistant MM cells with minimal cytotoxicity to normal hematopoietic cells, and further synergized with the proteasomal-inhibitor bortezomib to effectively kill drug-resistant MM cells in vitro and in a myeloma xenograft model. Conclusions This study identifies SMAD1 regulation of NF-κB1/TNFAIP8 and ID1-p21/p27 as critical axes of MM drug resistance and provides a potentially new therapeutic strategy to treat drug resistance MM through targeted inhibition of SMAD1.

show abstract

Section: Discussionsupporting

confidence: 74%

SMAD1 as a biomarker and potential therapeutic target in drug-resistant multiple myeloma

Zhang

Faruq

et al. 2021

Biomark Res

View full text Add to dashboard Cite

show abstract

“…Using all-atom molecular dynamics simulations, we first establish a DNA-NF-κB system based on the structure of NF-κB p50/p65 heterodimer in a complex with immunoglobulin DNA (PDB entry: 1VKX) (Figure a). The selected DNA segments are 25 base pairs with the sequence of AGCGATTTGAGAAACTTCATCATCA, which is not a recognized DNA binding site. , Our results demonstrate that the binding of NF-κB molecules substantially suppresses the bending of DNA segments. In the binding region, the DNA bending angle is reduced by a factor of α = 0.82 (Figure d).…”

Section: Unspecific Interactions With Nf-κb Regulate Dna Conformationmentioning

confidence: 81%

Gradient Nanoconfinement Facilitates Binding of Transcriptional Factor NF-κB to Histone- and Protamine-DNA Complexes

et al. 2023

View full text Add to dashboard Cite

Mechanically induced chromosome reorganization plays important roles in transcriptional regulation. However, the interplay between chromosome reorganization and transcription activities is complicated, such that it is difficult to decipher the regulatory effects of intranuclear geometrical cues. Here, we simplify the system by introducing DNA, packaging proteins (i.e., histone and protamine), and transcription factor NF-κB into a well-defined fluidic chip with changing spatical confinement ranging from 100 to 500 nm. It is uncovered that strong nanoconfinement suppresses higher-order folding of histone-and protamine-DNA complexes, the fracture of which exposes buried DNA segments and causes increased quantities of NF-κB binding to the DNA chain. Overall, these results reveal a pathway of how intranuclear geometrical cues alter the open/closed state of a DNAprotein complex and therefore affect transcription activities: i.e., NF-κB binding.

show abstract

“…Literature also suggests that multivalent proteins form larger aggregates in response to increased MMC via self-condensation (Shin and Brangwynne, 2017; Watanabe et al ., 2018; Jalihal et al ., 2020, 2021; Keber et al ., 2021). While free EGFP depicts a non-specific weaker aggregation in the cytoplasm, NFκβ, a protein with DNA binding domain (Yan et al ., 2012; Smith et al ., 2019; Vonderach et al ., 2019), shows globular self aggregation in response to hypertonic shock in NIH/3T3 cells expressing p65-EGFP, a subunit of the NFκβ complex ( Fig S4A-i ). However, in Heclin treated NIH/3T3, NFκβ shows drastically massive, irregularly shaped aggregates ( Fig S4A-ii ) compared to the globular condensates from hypertonic shock.…”

Section: Resultsmentioning

confidence: 99%

Probing the role of macromolecular crowding in cell volume regulation using fluorescence anisotropy

Biswas

Ray

Jana

et al. 2022

Preprint

View full text Add to dashboard Cite

Cytoplasmic macromolecular crowding (MMC) influences multiple cellular functions. Using fluorescence anisotropy of EGFP, we explore the homeostasis of MMC in the cytoplasm and its role in cell volume regulation. Individual cells of different lineages maintain a distinctly unique average cytoplasmic MMC for considerably long durations. Despite diffusion, actin cytoskeleton facilitates spatially heterogeneous MMC in the cytoplasm. While hypertonic-stress triggers regulatory volume increase (RVI), other methods of increasing cytoplasmic MMC fail to start RVI, suggesting that cells lack capabilities for MMC homeostasis. During spreading or microtubule-depolymerized state, cells neglect changes in cytoplasmic MMC to undergo volume regulation. Inhibition of TNFR1 increases the membrane tension and deprives cells of their ability to undergo volume regulation. Current understanding contemplates that cytoplasmic MMC, the mechanical state of the plasma membrane or the actin cytoskeleton, could be sensors for cell volume regulation. Our observations establish the irrelevance of cytoplasmic MMC and the significance of plasma membrane tension in setting off the cell volume regulation machinery.

show abstract

The regulation of sequence specific NF-κB DNA binding and transcription by IKKβ phosphorylation of NF-κB p50 at serine 80

Cited by 20 publications

References 43 publications

SMAD1 as a biomarker and potential therapeutic target in drug-resistant multiple myeloma

SMAD1 as a biomarker and potential therapeutic target in drug-resistant multiple myeloma

Gradient Nanoconfinement Facilitates Binding of Transcriptional Factor NF-κB to Histone- and Protamine-DNA Complexes

Probing the role of macromolecular crowding in cell volume regulation using fluorescence anisotropy

Contact Info

Product

Resources

About