The rat probasin gene promoter directs hormonally and developmentally regulated expression of a heterologous gene specifically to the prostate in transgenic mice.

Abstract

An expression cassette carrying 426 basepairs of the rat probasin (PB) gene promoter and 28 basepairs of 5'-untranslated region is sufficient to target the expression of the bacterial chloramphenicol acetyltransferase (CAT) gene specifically to the prostate in transgenic mice. The PB-CAT transgene was expressed in three of five (60%) independent lines of mice, and this expression, as reported previously for the endogenous rat gene, was male specific, restricted primarily to the lateral, dorsal, and ventral lobes of the prostate, with only very low levels of CAT activity detected in the anterior prostate and seminal vesicles. The developmental and hormonal regulation of the transgene also paralleled that reported for the rat gene, with a 70-fold increase in CAT activity in the mouse prostate observed between 2-7 weeks of age, a time corresponding to sexual maturation. PB-CAT activity in the prostate declined after castration to 3.5% of the precastration level, and the CAT activity in castrated males approached precastration levels when mice were supplemented with testosterone. Transgene expression in castrated males was not induced by dexamethasone. Coinjection of PB-CAT with a chicken lysozyme gene matrix attachment region resulted in their cointegration and further restricted the pattern of PB-CAT to the dorsolateral prostate, with suppressed expression observed in the ventral prostate. These studies demonstrate that a minimal rat probasin promoter can target heterologous gene expression specifically to the prostate in a developmentally and hormonally regulated fashion.

The impact of bcl-2 expression and bax deficiency on prostate homeostasis in vivo

“…The ability to assess the molecular regulation of homeostatic cell numbers in the prostate in vivo has been greatly facilitated by the use of gene promoter elements to enable targetted gene expression. The rat probasin gene promoter has been demonstrated to be of particular utility in this context (Greenberg et al, 1994(Greenberg et al, , 1995. Using the probasin gene promoter we were able to target expression of a human bcl-2 transgene speci®cally to the prostatic glandular epithelium.…”

“…Neurons which do not establish appropriate functional connections are then deleted. In contrast to these systems, transgene expression using the probasin promoter element is delayed until the onset of sexual maturation at approximately 2 ± 7 weeks, postnatally (Greenberg et al, 1994). Additionally, the average life span of a human prostatic glandular epithelial has been estimated to be in excess of 2 years (Tunn et al, 1989).…”

“…The generation of the transgenic mice, tail DNA isolation and PCR screening were described previously (Greenberg et al, 1994). The sequences for the PCR primers used for the probasin-bcl-2 transgenic mice were the following (5' to 3'): PB1-28, CTTGTCAGTGAGGTCCAGATACCTACAG; Bcl-2 reverse, CCTCTGCGACAGCTTATAATGGATGTAC.…”

“…Recently, our ability to assess the impact of individual gene products in the prostate has been greatly facilitated by the characterization of gene promoters that enable targetting to the prostate (Greenberg et al, 1994;Maroulakou et al, 1994;Pang et al, 1997;Cleutjens et al, 1997;Zhang et al, 1997). The most extensively studied transgenic model involves the targeting of transgene expression using the probasin promoter (Greenberg et al, 1995;Gingrich et al, 1996Gingrich et al, , 1997.…”

Mouse models of prostate cancer

“…The rat probasin protein belongs to the ligand carrier family of proteins and is localized speci®cally in the epithelial cell nuclei and the ducts of the dorsolateral and ventral prostate (Greenberg et al, 1994). Transcription of the probasin gene is subject to steroid hormone (including androgen and to a lesser extent glucocorticoid) and developmental regulation (increased expression with sexual maturation) (Greenberg et al, 1994).…”