The proteasomal deubiquitinating enzyme PSMD14 regulates macroautophagy by controlling Golgi-to-ER retrograde transport

Abstract

31Ubiquitination regulates several biological processes. Here, we search for ubiquitin-related 32 genes implicated in protein membrane trafficking performing a High-Content siRNA 33 Screening including 1,187 genes of the human "ubiquitinome" using Amyloid Precursor 34 Protein (APP) as a reporter. We identified the deubiquitinating enzyme PSMD14, a subunit 35 of the 19S regulatory particle of the proteasome, specific for K63-Ub chains in cells, as a 36novel key regulator of Golgi-to-endoplasmic reticulum (ER) retrograde transport. Silencing 37 or pharmacological inhibition of PSMD14 caused a robust and rapid inhibition of Golgi-to-38 ER retrograde transport which leads to a potent blockage of macroautophagy by a 39 mechanism associated with the retention of Atg9A and Rab1A at the Golgi apparatus. 40Because pharmacological inhibition of the proteolytic core of the 20S proteasome did not 41 recapitulate these effects, we concluded that PSMD14, and their K-63-Ub chains, act as a 42 crucial regulator factor for macroautophagy by controlling Golgi-to-ER retrograde 43 transport. 44

Negative modulation of macroautophagy by HERPUD1 is counteracted by an increased ER-lysosomal network with impact in drug-induced stress cell survival

“…The supernatants were collected, and protein concentration was quantified using the BCA assay (ThermoFisher Scientific). The protein extracts were denatured at 65°C for 5 min and analyzed using our previous described methods (González et al 2017; Bustamante et al 2020).…”

“…Cells grown on glass coverslips were washed with PBS-Ca 2+ /Mg 2+ and then fixed, permeabilized and stained using our published protocols (Bustamante et al 2020; Cavieres et al 2020). The images were acquired using a TCS SP8 laser-scanning confocal microscope (Leica Microsystems, Wetzlar, Germany) equipped with a 63× oil immersion objective (1.4 NA), photomultipliers (PMT), hybrid detectors (HyD) system using 405 nm, 488 nm, 561 nm and 643 nm laser lines for excitation running the LASX Leica software.…”

“…The copyright holder for this preprint this version posted June 14, 2021. ; https://doi.org/10.1101/2021.06.14.447273 doi: bioRxiv preprint previously described (Bustamante et al 2020). The specific primer pairs used for CYCLOPHILIN-A, CYCA (NM_001300981.2) and XBP1 (NM_001079539.2) were the following: CYCA-F TCGAGTTGTCCACAGTCAGC, CYCA-R TTCATCTGCACTGCCAAGAC, XBP1-F CGCTTGGGGATGGATGCCCTG and XBP1-R CCTGCACCTGCTGCGGACT.…”

“…Total RNA extraction from HeLa cells, oligo-dT and MMLV reverse transcriptase and quantitative reverse transcription PCR of the cDNA template (RT-PCR) was carried out as previously described (Bustamante et al 2020). The specific primer pairs used for CYCLOPHILIN-A, CYCA (NM_001300981.2) and XBP1 (NM_001079539.2) were the following: CYCA-F TCGAGTTGTCCACAGTCAGC, CYCA-R TTCATCTGCACTGCCAAGAC, XBP1-F CGCTTGGGGATGGATGCCCTG and XBP1-R CCTGCACCTGCTGCGGACT.…”

“…Inhibitors of the proteasome 20S catalytic core with the use of β-subunits blockers triggers an enhancement in the biogenesis of autophagosomes (Zhu, Dunner, and McConkey 2010). In contrast, impairment of the proteasome 19S regulatory particle with an inhibitor of PSMD14, a proteasomal deubiquitinating enzyme, blocks the biogenesis of autophagosomes (Demishtein et al 2017; Bustamante et al 2020). To date a limited number of substrates of the UPS system are known to play a regulatory role in autophagy (Jia and Bonifacino 2019; Thayer et al 2020) and many aspects about the functional role of this interconnected network between autophagy and UPS remain elusive.…”