The Presence of a Short Form of p53 in Chicken Lymphoblastoid Cell Lines during Apoptosis

Abstract

ABSTRACT. To examine the roles of a short form of p53 in the regulation of apoptosis in chicken lymphoblastoid tumor cell lines derived from Marek's disease (MD) and avian leukosis (AL), the expressions of the p53 proteins were analyzed in these cell lines in which apoptosis was chemically induced. In MSB1-O derived from MD, the expression of a 40 kDa protein of p53 was decreased and that of a 32 kDa protein, a short form of p53, was increased during apoptosis induced by actinomycin D. In 1104B1 derived from AL, the expressions of 42 and 32 kDa of p53 were increased during the apoptosis. The short form of p53 was undetectable in these cell lines when apoptosis was blocked by the pretreatment with endonuclease inhibitor, Zn 2+ , protease inhibitors, TPCK and TLCK, or caspase inhibitor, Z-VAD-FMK. In the transcriptional level, the expressions of bcl-2 and IAP were decreased in these cell lines during actinomycin Dinduced apoptosis, but no change was detected in the expression level of p53. These results suggest that, in these chicken tumors, the short form of p53 could play a role in the initiation of apoptosis induced by the chemotherapeutic compound, and that the regulation of its expression may be important for the maintenance of transformation status. KEY WORDS: apoptosis, Marek's disease, p53.

MicroRNA Profile of Marek's Disease Virus-Transformed T-Cell Line MSB-1: Predominance of Virus-Encoded MicroRNAs

“…The MSB-1 cell line has both integrated and circular copies of the MDV-1 genome (56) and induces tumors when it is inoculated into susceptible gga-mir-7 TGGAAGACTAGTGATTTTGTTG 3 Z_random 12717978 12718086 gga-mir-15a TAGCAGCACATAATGGTTTGT 28 1 161540787 161540869 gga-mir-15b TAGCAGCACATCATGGTTTGCA 9 9 21649291 21649381 1 161540645 161540728 gga-mir-16 TAGCAGCACGTAAATATTGGTG 82 9 21649116 21649209 gga-mir-17-5p CAAAGTGCTTACAGTGCAGGTAA 55 1 140631124 140631208 gga-mir-18a TAAGGTGCATCTAGTGCAGATA 10 1 140630969 140631061 gga-mir-18b TAAGGTGCATCTAGTGCAGTTA 10 4 3781954 3782037 gga-mir-19a TGTGCAAATCTATGCAAAACTGA 71 1 140630835 140630915 gga-mir-19b TGTGCAAATCCATGCAAAACTGA 71 1 140630526 chickens (21,35). As reported for some MD tumors, these cells also showed truncated forms of p53 tumor suppressor protein (62). Northern blot analysis of the expression of MDV-induced miRNAs in MSB-1 cells showed that many of the miRNAs are expressed at much higher levels than those in infected CEF (8,9).…”

The centrosomal FOP protein is required for cell cycle progression and survival

“…3C) and with Actinomycin D, another p53 activator, 29 in chicken lymphoblastoid cell lines. 30 To support a role for p53 in cell death following FOP deletion, we analyzed by real-time quantitative PCR (RT-qPCR) the expression of two p53 transcriptional targets involved in the apoptotic compared to control cells, particularly at the last day of analysis. This indicates that cells without FOP can proceed through mitosis and daughter cells progress in G 1 to some extent, but do not enter S phase before dying.…”

Apoptosis gene profiling reveals spatio-temporal regulated expression of the p53/Mdm2 pathway during lens development

“…Intriguingly, we identified two short forms of p53 at 40 kDa and 32 kDa during chicken lens development and short forms of Mdm4/X at approximately 54 kDa and 52 kDa respectively in the mouse lens. The short forms of chicken p53 have been identified previously in chicken lymphoblastoid cell lines and the 32 kDa form in particular was shown to be pro-apoptotic in these lines (Takagi et al., 2006). Regarding Mdm4/X, there is evidence for short forms of Mdm4/X, which have biological activity by modulating p53 through differential splicing of p53-binding domains (Rallapalli et al., 1999; Chandler et al., 2006).…”