The Polymerase Chain Reaction

Jalali, Mehdi; Zaborowska, Justyna; Jalali, Morteza

doi:10.1016/b978-0-12-803077-6.00001-1

Cited by 29 publications

(29 citation statements)

References 14 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…In the initially presented methods, the target cDNA was detected after the end of the amplification step. Although, the real-time detection methods were then developed, and hence, amplification and detection steps were merged, some highly sensitive methods were also proposed to directly detect the target RNA without amplification [29][30][31].…”

Section: Rna Amplification-based Detection Methodsmentioning

confidence: 99%

“…In this technique, a mixture of sample DNA, primers, nucleotides, and DNA polymerase brings in a three-step temperature cycle, which consists of denaturation, primer hybridization, and extension. After increasing the number of DNA molecules, it could be detected by various methods like agarose gel electrophoresis [31,81,82].…”

Section: Reverse Transcription Polymerase Chain Reaction (Rt-pcr)mentioning

confidence: 99%

“…Thereafter, the amplification and detection steps have been combined together to decrease the total detection time and increase the sensitivity and accuracy of the method. This technique is known as real-time RT-PCR (rRT-PCR) or quantitative RT-PCR (qRT-PCR) and is represented in the next subsection [31,83,84].…”

Section: Reverse Transcription Polymerase Chain Reaction (Rt-pcr)mentioning

confidence: 99%

“…SYBR Green binds to any doublestrand DNA and light is emitted after binding. In clinical diagnosis, there have been some false-positive results due to the binding of SYBR Green dye to primer-dimers or other DNA double strands in the mixture [31,82]. To resolve this problem, specific fluorescent probes, also known as reporters were developed, which only worked in the presence of a specific DNA sequence.…”

Section: Real-time Rt-pcr (Rrt-pcr)mentioning

confidence: 99%

See 3 more Smart Citations

Laboratory detection methods for the human coronaviruses

Shabani

Dowlatshahi

Abdekhodaie

2020

Eur J Clin Microbiol Infect Dis

View full text Add to dashboard Cite

Coronaviruses are a group of envelop viruses which lead to diseases in birds and mammals as well as human. Seven coronaviruses have been discovered in humans that can cause mild to lethal respiratory tract infections. HCoV-229E, HCoV-OC43, HCoV-NL63, and HCoV-HKU1 are the low-risk members of this family and the reason for some common colds. Besides, SARS-CoV, MERS-CoV, and newly identified SARS-CoV-2, which is also known as 2019-nCoV, are the more dangerous viruses. Due to the rapid spread of this novel coronavirus and its related disease, COVID-19, a reliable, simple, fast, and low-cost detection method is necessary for patient diagnosis and tracking worldwide. Human coronaviruses detection methods were classified and presented in this article. The laboratory detection techniques include RT-PCR, RT-LAMP, electrochemical and optical biosensors for RNA detection, and whole virus or viral proteins detection assays.

show abstract

Section: Rna Amplification-based Detection Methodsmentioning

confidence: 99%

Section: Reverse Transcription Polymerase Chain Reaction (Rt-pcr)mentioning

confidence: 99%

Section: Reverse Transcription Polymerase Chain Reaction (Rt-pcr)mentioning

confidence: 99%

Section: Real-time Rt-pcr (Rrt-pcr)mentioning

confidence: 99%

See 2 more Smart Citations

Laboratory detection methods for the human coronaviruses

Shabani

Dowlatshahi

Abdekhodaie

2020

Eur J Clin Microbiol Infect Dis

View full text Add to dashboard Cite

show abstract

“…Kemampuan mengkatalisis reaksi polimerasi DNA pada proses PCR yang terjadi pada tahap ekstensi. Konsentrasi enzim polimerase yang tidak tepat dapat menyebabkan hasil pita DNA yang smear, maka dari itu optimasi konsentrasi enzim polimerase diperlukan agar proses amplifikasi berjalan dengan baik [18]. Hasil elektroforegram (Gambar 6) dari optimasi konsentrasi Taq Polimerase pada konsentrasi 2 U dan 1,5 U terjadi smear pada pita DNA yang menunjukan terjadinya kelebihan konsentrasi enzim polimerase.…”

Section: Gambar 1 Hasil Isolasi Dna Salmonella Atccunclassified

Deteksi Cepat Gen InvA pada Salmonella spp. Dengan Metode PCR

2019

View full text Add to dashboard Cite

Salmonella spp. merupakan penyebab infeksi utama pada manusia melalui rute oral dengan cara mengkontaminasi makanan dan minuman. Penyakit yang disebabkan oleh Salmonella spp. disebut salmonellosis. Salmonella spp. memiliki gen invA yang menyebabkan patogen pada manusia. Deteksi gen InvA dapat dilakukan dengan metode PCR. Tujuan penelitian ini adalah untuk pengembangan metode deteksi cepat Gen InvA pada Salmonella spp. dengan metode PCR. Tahapan metode penelitian dimulai dari kultur Salmonella ATCC, Isolasi DNA Salmonella ATCC, Analisis Kuantitatif DNA Salmonella ATCC, Desain primer spesifik untuk deteksi gen InvA, Karakterisasi primer, Optimasi komponen PCR. Hasil isolasi DNA Salmonella ATCC yang didapat dengan konsentrasi DNA sebesar 4,5 ng/ul dengan kemurnian DNA 1,66. Primer PCR yang telah didesain untuk deteksi gen InvA terdiri dari satu pasang primer, yaitu InvA-F: 5’ TCGTCATTCCATTACCTACC 3’dan InvA-R: 5’ AAACGTTGAAAAACTGAGGA 3’ yang menghasilkan produk PCR gen InvA sepanjang 119 bp. Gen InvA dapat dideteksi dengan cepat menggunakan metode PCR yang telah dioptimasi komponen PCR.

show abstract

Hidradenitis suppurativa (HS)

2023

Handbook of Skin Disease Management

View full text Add to dashboard Cite

Hidradenitis suppurativa (HS) is an autoinflammatory skin disease affecting roughly 1-4% worldwide. Symptoms of HS include abscesses, sinus tracts and scarring, which can cause immense pain and discomfort for patients. The disease impacts the pilosebaceous units in apocrine gland-bearing regions with skin-to-skin contact. Thus far, the cause of HS is unknown, however, hyperkeratosis of the follicular epithelium is most likely the first event in the development of HS lesions. Current treatment options range from topical-and systemic treatments, light therapy, and biological agents to surgical intervention. These therapies do not warrant optimal results; therefore, the aim of this report is to choose new potential drug targets.In that respect, we present specific isoforms of aquaporins (AQP3 and AQP5) and matrix metalloproteinases (MMP-2, MMP-8, and MMP-9) as possible targets that may be involved in the early and late stages of HS, respectively. Although the particular roles of AQP3 and AQP5

show abstract

The Polymerase Chain Reaction

Cited by 29 publications

References 14 publications

Laboratory detection methods for the human coronaviruses

Laboratory detection methods for the human coronaviruses

Deteksi Cepat Gen InvA pada Salmonella spp. Dengan Metode PCR

Hidradenitis suppurativa (HS)

Contact Info

Product

Resources

About