The phylogenetic placement of Psechridae within Entelegynae and the convergent origin of orb-like spider webs

Abstract

Evolutionary convergence of phenotypic traits provides evidence for their functional success. The origin of the orb web was a critical event in the diversification of spiders that facilitated a spectacular radiation of approximately 12 000 species and promoted the evolution of novel web types. How the orb web evolved from ancestral web types, and how many times orb‐like architectures evolved in spiders, has been debated for a long time. The little known spider genus Fecenia (Psechridae) constructs a web that resembles the archetypical orb web, but morphological data suggest that Psechridae (Psechrus + Fecenia) does not belong in Orbiculariae, the ‘true orb weavers’, but to the ‘retrolateral tibial apophysis (RTA) clade’ consisting mostly of wandering spiders, but also including spiders building less regular webs. Yet, the data are sparse and no molecular phylogenetic study has estimated Fecenia's exact position in the tree of life. Adding new data to sequences pulled from GenBank, we reconstruct a phylogeny of Entelegynae and phylogenetically test the monophyly and placement of Psechridae, and in doing so, the alternative hypotheses of monophyletic origin of the orb web and the pseudo‐orb versus their independent origins, a potentially spectacular case of behavioural convergence. We also discuss the implications of our results for Entelegynae systematics. Our results firmly place a monophyletic Psechridae within the RTA clade, phylogenetically distant from true orb weavers. The architectural similarities of the orb and the pseudo‐orb are therefore clearly convergent, as also suggested by detailed comparisons of these two web types, as well as the spiders' web‐building behaviours and ontogenetic development. The convergence of Fecenia webs with true orbs provides a remarkable opportunity to investigate how these complex sets of traits may have interacted during the evolution of the orb.

Total evidence analysis of the phylogenetic relationships of Lycosoidea spiders (Araneae, Entelegynae)

“…The grate-shaped tapetum of psechrids mandated inclusion in Lycosoidea (Homann 1971). In our analysis Psechridae (represented by Psechrus) cluster among the Lycosoidea, as has been the case in all previous quantitative analyses (Griswold 1993;Griswold et al 1999;Raven and Stumkat 2005;Griswold et al 2005;Bayer and Schönhofer 2013;Agnarsson et al 2013a;Agnarsson et al 2013b). In our analyses psechrids appear as sister group of the clade formed by Oxyopidae, Thomisidae, Pisauridae, Lycosidae, Cupiennius and Nilus O. P.-Cambridge, 1876 in the Bayesian analysis (Fig.…”

“…On the basis of previous cladistic analyses (Griswold 1993;Griswold et al 1999Griswold et al , 2005Raven and Stumkat 2005;Spagna and Gillespie 2008;Miller et al 2010;Agnarsson et al 2013aAgnarsson et al , 2013bRamírez 2014), we include spiders from the RTA Clade with either a grate-or non-grate-shaped tapetum in the eyes to test the limits of Lycosoidea. Previous phylogenetic analyses of high-level relationships of spiders have included large numbers of cribellate taxa (Griswold et al 1999(Griswold et al , 2005Spagna and Gillespie 2008;Miller et al 2010) because these are reasoned to be more likely to straddle the basal nodes of the phylogeny of higher groups than are their relatives that have lost the cribellum (Griswold et al 2005).…”

Rounding up the usual suspects: a standard target‐gene approach for resolving the interfamilial phylogenetic relationships of ecribellate orb‐weaving spiders with a new family‐rank classification (Araneae, Araneoidea)

“…It is molecular evidence, albeit from the same genes but with a diverse array of taxon samples, that strongly associates Nicodamoidea with Araneoidea (Blackledge et al., ; Miller et al., ; Spagna et al., ; Dimitrov et al., , ; Agnarsson et al., ), although Nicodamoidea was contradicted by Agnarsson et al. (). That result is corroborated by our analysis, with relatively good (73) bootstrap support, and we consider this the best supported working hypothesis.…”

Rapid dissemination of taxonomic discoveries based on DNA barcoding and morphology

“…We used the universal primers LCOI1490 (GGTCAACAAATCATAAAGATATTGG) and HCOI2198 (TAAACTTCAGGGTGACCAAAAAATCA) for COI, as well as ITS5.8 (GGGACGATGAAGAACGCAGC) and ITS4 (TCCTCCGCTTATTGATATGC) for ITS2 to obtain PCR products following standard protocols3348. Amplified fragments were sequenced in both directions by the Tsingke Biological Technology (Wuhan, China) and then assembled and proofread using the Chromaseq module in Mesquite employing Phred and Phrap.…”