The number, distribution and functional implication of sulfhydryl groups in rabbit muscle aldolase

Lai, Chun‐Yen; Chen, C.; Smith, J.D.; Horecker, B.L.

doi:10.1016/0006-291x(71)90189-6

Cited by 18 publications

(7 citation statements)

References 12 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The peptide contains the cysteinyl residue involved in the catalytic activity of native aldolase [36] at position 341. This is in good agreement with the data of Lai et d. [43] who located this residue at position 339.…”

Section: Sequence Of Peptide P(c Y S ) (Residues 334-344)supporting

confidence: 93%

On the Mechanism of Formation of a Partially Active Aldolase by Tryptic Digestion

Biszku

Sajgó

Solti

et al. 1973

European Journal of Biochemistry

View full text Add to dashboard Cite

The limited proteolysis of a fully active mercury derivative of rabbit muscle aldolase affects all four subunits of the enzyme, but not in a uniform way. At least four out of the nine peptides liberated are cleaved off from only two subunits. The specific activity of the product (aldolase-T) is 50°/, of that of the native enzyme. The combined kinetic and peptide analytical study of aldolase-T formation has shown that the diminished activity is the consequence of the splitting off of a particular tyrosine-containing peptide from all four subunits of aldolase, and of the cleavage of a peptide bond in the vicinity of residue Cys-341 in only two subunits. The data presented, together with the results of the polyacrylamide gel electrophoresis of aldolase-T in the absence and presence of sodium dodecylsulfate, support the idea that the structure of oligomeric aldolase is of type AABB. Large segments of one kind of the subunits can be split off without affecting the tetrameric structure. A tentative sequence of the C-terminal 60 amino acids of aldolase is also presented.According to our present knowledge rabbit muscle aldolase consists of four polypeptide chains of closely similar primary structure and the subunits operate independently of each other [i]. However, the investigations of the action of carboxypeptidase on the enzyme suggested that there were differences in the steric structure of the subunits [2-41. The tryptic digestion of native proteins proved to be a very sensitive method to reveal changes in the steric structure of enzymes following chemical modifications [5,6]. Therefore we undertook to study the structure of aldolase by tryptic digestion.We have shown previously that native aldolase is unsuitable for proteolytic investigations since in this case only large amounts of trypsin bring about detectable digestion and the protein is degraded with the parallel loss of enzymatic activity. We found however, a suitable object for the above type of studies in a fully active mercury derivative of aldolase, namely sldolase-(SHg),, in which two SH groups per subunit are blocked with p-mercuribenzoate. Although this modification induces changes in the steric structure of the protein, yet aldolase-(SHg), retains full enzymatic activity [7,8]. Addition of small amounts of trypsin to this mercury derivative of aldolase led to limited proteolysis, inasmuch as after splitting of about 24 peptide linkages per mole of aldolase the digestion stopped.Enzyme. Fructose-1,6-bisphosphate : D-glyceraldehyde-3-phosphate lyase (EC 4.1.2.13).

show abstract

Section: Sequence Of Peptide P(c Y S ) (Residues 334-344)supporting

confidence: 93%

On the Mechanism of Formation of a Partially Active Aldolase by Tryptic Digestion

Biszku

Sajgó

Solti

et al. 1973

European Journal of Biochemistry

View full text Add to dashboard Cite

show abstract

“…Aldolase, containing 2 reactive surface accessible cysteine residues out of 8 total [54], is able to conjugate to MNS (Fig. S14).…”

Section: Resultsmentioning

confidence: 99%

Challenges in the evaluation of thiol-reactive inhibitors of human protein disulfide Isomerase

Foster

Thorpe

2017

Free Radical Biology and Medicine

View full text Add to dashboard Cite

This paper addresses how to evaluate the efficacy of the growing inventory of thiol-reactive inhibitors of mammalian protein disulfide isomerase (PDI) enzymes under realistic concentrations of potentially competing thiol-containing peptides and proteins. For this purpose, we introduce a variant of the widely-used reductase assay by using a commercially-available cysteine derivative (BODIPY FL L-Cystine; BD-SS) that yields a 55-fold increase in fluorescence (excitation/emission; 490/513 nm) on scission of the disulfide bond. This plate reader-compatible method detects human PDI down to 5–10 nM, can utilize a range of thiol substrates (including 5 μM dithiothreitol, 10 μM reduced RNase thiols, and 5 mM glutathione; GSH), and can operate from pH 6–9.5 in a variety of buffers. PDI assays often employ low micromolar levels of substrates leading to ambiguities when thiol-directed inhibitors are evaluated. The present work utilizes 5 mM GSH for both pre-incubation and assay phases to more realistically reflect the high concentration of thiols that an inhibitor would encounter intracellularly. Extracellular PDI faces a much lower concentration of potentially competing thiols; to assess reductase activity under these conditions, the pre-reduced PDI is treated with inhibitor and then fluorescence increase upon reduction of BD-SS is followed in the absence of additional competing thiols. Both assay modes were tested with four mechanistically diverse PDI inhibitors. Two reversible reagents, 3,4-methylenedioxy-β-nitrostyrene (MNS) and the arsenical APAO, were found to be strong inhibitors of PDI in the absence of competing thiols, but were ineffective in the presence of 5 mM GSH. A further examination of the nitrostyrene showed that MNS not only forms facile Michael adducts with GSH, but also with the thiols of unfolded proteins (Kd values of 7 and <0.1 μM, respectively) suggesting the existence of multiple potential intracellular targets for this membrane-permeant reagent. The inhibition of PDI by the irreversible alkylating agent, the chloroacetamide 16F16, was found to be only modestly attenuated by 5 mM GSH. Finally, the thiol-independent flavonoid inhibitor quercetin-3-O-rutinoside was found to show equal efficacy in reoxidation and turnover assay types. This work provides a framework to evaluate inhibitors that may target the CxxC motifs of PDI and addresses some of the complexities in the interpretation of the behavior of thiol-directed reagents in vivo.

show abstract

“…Reaction with nontarget cysteine residues was limited by mutating the codons for four solvent‐exposed cysteines (C72, C239, C289, and C338; Lai et al 1971) to alanine codons. The resulting substituted protein, gtet, exhibited wt kinetics (Table 1).…”

Section: Resultsmentioning

confidence: 99%

“…The pPB14 clone expresses wt rabbit‐muscle Fru1,6P2 aldolase in pPB1. Of the eight cysteines present in aldolase, four are solvent accessible (C72, C239, C289, C338) (Lai et al 1971) and were substituted by alanine in pPB14 by modification of the overlap‐extension PCR method, as reviewed by Ling and Robinson (1997). The primers (National Biosciences, Inc.) for mutagenesis were: geneU, acgaccgagcgcagcgagtcagtgag; 72U, gaaccccgccatcgggggcgtc; 72L, gacgcccccgatggcggggttc; 107U, gttgtgggcatctgcgtagacaagg; 107L, tgtctacgcagatgcccacaa cacc; 239U, cctggccatgccgccacccagaagtattct; 239L, gagaatacttc tgggtggcggcatggccagg; 289U, caacaaggcccccctgctgaagccgtg; 289L, tcagcaggggggccttgttgatggcgt; 338U, cgccgcccaagggaagta caccccgag; 338L, gtacttcccttgggcggcgaggctgttgg; geneL, gctactgccgccaggcaaactgttttatca.…”

Section: Methodsmentioning

confidence: 99%

“…The pPB14 clone expresses wt rabbitmuscle Fru1,6P2 aldolase in pPB1. Of the eight cysteines present in aldolase, four are solvent accessible (C72, C239, C289, C338) (Lai et al 1971) and were substituted by alanine in pPB14 by modification of the overlap-extension PCR method, as reviewed by Ling and Robinson (1997). The primers (National Biosciences,…”

Section: Plasmids and Pcr Mutagenesismentioning

confidence: 99%

See 1 more Smart Citation

Chemical‐modification rescue assessed by mass spectrometry demonstrates that γ‐thia‐lysine yields the same activity as lysine in aldolase

et al. 2002

View full text Add to dashboard Cite

The role of active site residues in fructose 1,6-bisphosphate aldolase is investigated by chemical-modification rescue. An active-site mutation, K107C, is constructed in a background where the four solventaccessible cysteine residues are converted to alanine. The resulting mutant, tetK107C, when reacted with bromoethylamine (BrEA), shows a 40-fold increase in activity (to 80% that of wild type). Determination of the sites and their degree of modification using electrospray ionization Fourier transform mass spectrometry (ESI-FTMS) is developed, allowing correlation of activity after chemical modification rescue to the degree of modification. The stoichiometry of the reaction is 2.5 aminoethylations per subunit, as measured by ESI-FTMS. Protein modification with a double-labeled mix (1:1) of natural abundance isotope (d 0 -BrEA) and 2-bromoethyl-1,1,2,2-d4-amine hydrobromide (d 4 -BrEA), followed by dialysis and trypsin digestion, shows aminoethylated peptides as "twin peptides" separated by four mass units in ESI-FTMS analysis. Using this detection procedure under nondenaturing (native) conditions, C107 is aminoethylated, whereas the four buried thiols remain unlabeled. Aminoethylation of other residues is observed, and correlates with those peptides containing histidine, methionine, and/or the amino terminus. Quantification of the aminoethylation reaction is achieved by labeling with nondeuterated d 0 -BrEA under denaturing conditions following double labeling under native conditions. In addition to complete labeling all five thiols, the intensity of the d 0 -BrEA peak for C107 containing peptides increases, and the change in the d 0 /d 4 ratio between native and denaturing conditions shows 82 ± 4.5% aminoethylation at C107. This correlation of modification with the recovered activity, indicates that ␥-thia-lysine replaces lysine in the catalytic mechanism. Kinetic constants measured for the rescued K107C mutant enzyme with the substrates fructose 1-phosphate and fructose 1,6-bisphosphate are consistent with the role of the positively charged lysine binding to the C6-phosphate. ESI-FTMS, combined with this double-labeling procedure, allows precise identification of sites and measurement of degree of protein modification.

show abstract

The number, distribution and functional implication of sulfhydryl groups in rabbit muscle aldolase

Cited by 18 publications

References 12 publications

On the Mechanism of Formation of a Partially Active Aldolase by Tryptic Digestion

On the Mechanism of Formation of a Partially Active Aldolase by Tryptic Digestion

Challenges in the evaluation of thiol-reactive inhibitors of human protein disulfide Isomerase

Chemical‐modification rescue assessed by mass spectrometry demonstrates that γ‐thia‐lysine yields the same activity as lysine in aldolase

Contact Info

Product

Resources

About