The Novel Toll-Like Receptor 2 Agonist SUP3 Enhances Antigen Presentation and T Cell Activation by Dendritic Cells

Guo, Xueheng; Wu, Ning; Shang, Yue; Liu, Xin; Wu, Tao; Zhou, Yifan; Huang, Jiaoyan; Liao, Xuebin; Wu, Li

doi:10.3389/fimmu.2017.00158

Cited by 21 publications

(19 citation statements)

References 79 publications

(96 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The recognition of microbial components in DCs via TLR signaling can induce DC maturation, which sequentially links Ag uptake, presenting and inducing T cell responses (39,40). In contrast to our current finding in iMDCs, TLR2 ligation has been shown to enhance the ability of DCs to present Ags and activate effector T cell responses (41,42). Following TLR2 ligation, signaling cascades are activated through Toll/IL-1 receptor domain-containing adaptor molecules, such as MyD88, which leads to the activation of MAPKs and NF-kB (43).…”

Section: Discussionmentioning

confidence: 72%

TLR2 Stimulation Strengthens Intrahepatic Myeloid-Derived Cell-Mediated T Cell Tolerance through Inducing Kupffer Cell Expansion and IL-10 Production

Liu

et al. 2018

The Journal of Immunology

View full text Add to dashboard Cite

Hepatic APCs play a critical role in promoting immune tolerance in the liver. Recently, we have demonstrated that TLR2 stimulation on liver sinusoidal endothelial cells reverted their suppressive properties to induce T cell immunity. However, there is a paucity of information about how TLR2 stimulation modulates the immunological function of other hepatic APCs. In the current study, we investigated whether TLR2 stimulation influences the function of intrahepatic myeloid-derived cells (iMDCs) and elucidated the mechanisms involved in iMDC-induced T cell immunity. We could show that iMDCs from C57BL/6 mice can potently suppress T cell activation in a cell contact-independent manner. Ag presentation by iMDCs leads to naive CD8 T cell tolerance. To our surprise, instead of inducing cell functional maturation, TLR2 ligand palmitoyl-3-cysteine-serine-lysine-4 (P3C) stimulation further strengthens the suppressive and tolerogenic properties of iMDCs. After P3C administration, the population of Kupffer cells (KCs) of iMDCs dramatically increased. Mechanism analysis shows that KCs are essential for the enhanced inhibition of T cell activation by P3C-stimulated iMDCs. The iMDC-mediated CD8 T cell inhibition was mediated by soluble mediators, one of which was IL-10 secreted by KCs after P3C stimulation. IL-10 blockade could partially abolish iMDC-mediated T cell inhibition. Moreover, hepatitis B virus particle stimulation on iMDCs could also induce IL-10 production by the cells in a TLR2-dependent way. Our results have implications for our understanding of liver-specific tolerance and for the development of strategies to overcome T cell tolerance in situations such as chronic viral liver infections.

show abstract

Section: Discussionmentioning

confidence: 72%

TLR2 Stimulation Strengthens Intrahepatic Myeloid-Derived Cell-Mediated T Cell Tolerance through Inducing Kupffer Cell Expansion and IL-10 Production

Liu

et al. 2018

The Journal of Immunology

View full text Add to dashboard Cite

show abstract

“…Here we describe the actions of a potent adjuvant, Diprovocim, that engages and activates human and mouse TLR1/TLR2 heterodimers. Diprovocim bears no structural similarity to other reported synthetic chemical ligands, nor to the natural ligands that activate TLR1/TLR2 (22)(23)(24)(25)(26). Diprovocim is more potent and efficacious in activating human TLR1/TLR2 than Pam 3 CSK 4 (SI Appendix, Fig.…”

Section: Discussionmentioning

confidence: 99%

Adjuvant effect of the novel TLR1/TLR2 agonist Diprovocim synergizes with anti–PD-L1 to eliminate melanoma in mice

Wang

Morin

et al. 2018

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

Successful cancer immunotherapy entails activation of innate immune receptors to promote dendritic cell (DC) maturation, antigen presentation, up-regulation of costimulatory molecules, and cytokine secretion, leading to activation of tumor antigen-specific cytotoxic T lymphocytes (CTLs). Here we screened a synthetic library of 100,000 compounds for innate immune activators using TNF production by THP-1 cells as a readout. We identified and optimized a potent human and mouse Toll-like receptor (TLR)1/TLR2 agonist, Diprovocim, which exhibited an EC of 110 pM in human THP-1 cells and 1.3 nM in primary mouse peritoneal macrophages. In mice, Diprovocim-adjuvanted ovalbumin immunization promoted antigen-specific humoral and CTL responses and synergized with anti-PD-L1 treatment to inhibit tumor growth, generating long-term antitumor memory, curing or prolonging survival of mice engrafted with the murine melanoma B16-OVA. Diprovocim induced greater frequencies of tumor-infiltrating leukocytes than alum, of which CD8 T cells were necessary for the antitumor effect of immunization plus anti-PD-L1 treatment.

show abstract

“…Real-time polymerase chain reaction (RT-PCR) was conducted using a 7500 real-time PCR system (Applied Biosystems Corp., Foster City, CA, USA), SYBR Green Real-time PCR Master Mix (Sigma) was used according to the manufacturer's instructions. 27 In this study, the primer for miR-4319 is: 5 0 -GTCGTATC CAGTGCAGGGTCCGAGGTATTCGCACTGGAT ACGACGTGGCT-3 0 . For miR-4319 RT-PCR: 5 0 -CA CCCAGAGCAAAGCCAC-3 0 (forward) and 5 0 -GTG CAGGGTCCGAGGT-3 0 (reverse); for control gene (U6) RT primer: 5 0 -GTCGTATCCAGTGCAGGGTC CGAGGTATTCGCACTGGATACGACAAAATAT GGAA-3 0 ; for control gene (U6) RT-PCR: 5 0 -TGCG GGTGCTCGCTTCGGCAGC-3 0 (forward) and 5 0 -GTGCAGGGTCCGAGGT-3 0 (reverse).…”

Section: Real-time Polymerase Chain Reactionmentioning

confidence: 99%

MiR‐4319 suppresses colorectal cancer progression by targeting ABTB1

Huang

Zhang

et al. 2019

UEG Journal

View full text Add to dashboard Cite

Background Colorectal cancer is one of the highly malignant cancers with a poor prognosis. The exact mechanism of colorectal cancer progression is not completely known. Recently, microRNAs (miRNAs, miRs) were suggested to participate in the regulation of multiple cancer development, including colorectal cancer. Methods MiR-4319 expression in colorectal cancer patient samples was detected by real-time polymerase chain reaction. MiR-4319 was knocked down in the colorectal cancer cells by siRNA transfection to study the role of miR-4319 in the cell cycle and proliferation of colorectal cancer cells. Results MiR-4319 expression was found to be inverse correlated with survival in colorectal cancer patients. Overexpression of miR-4319 markedly reduced the proliferation of colorectal cancer cells and altered cell cycle distribution. A further experiment showed that ABTB1 is the target gene of miR-4319. MiR-4319 was regulated by PLZF. Conclusion Our studies indicated that reduced expression of miR-4319 was correlated with poor prognosis in colorectal cancer patients; miR-4319 also suppressed colorectal cancer cell proliferation by targeting ABTB1. ABTB1 might become an excellent therapeutic target for colorectal cancer treatment.

show abstract

The Novel Toll-Like Receptor 2 Agonist SUP3 Enhances Antigen Presentation and T Cell Activation by Dendritic Cells

Cited by 21 publications

References 79 publications

TLR2 Stimulation Strengthens Intrahepatic Myeloid-Derived Cell-Mediated T Cell Tolerance through Inducing Kupffer Cell Expansion and IL-10 Production

TLR2 Stimulation Strengthens Intrahepatic Myeloid-Derived Cell-Mediated T Cell Tolerance through Inducing Kupffer Cell Expansion and IL-10 Production

Adjuvant effect of the novel TLR1/TLR2 agonist Diprovocim synergizes with anti–PD-L1 to eliminate melanoma in mice

MiR‐4319 suppresses colorectal cancer progression by targeting ABTB1

Contact Info

Product

Resources

About