The Non-JAZ TIFY Protein TIFY8 from Arabidopsis thaliana Is a Transcriptional Repressor

Abstract

Jasmonate (JA) signalling is mediated by the JASMONATE-ZIM DOMAIN (JAZ) repressor proteins, which are degraded upon JA perception to release downstream responses. The ZIM protein domain is characteristic of the larger TIFY protein family. It is currently unknown if the atypical member TIFY8 is involved in JA signalling. Here we show that the TIFY8 ZIM domain is functional and mediated interaction with PEAPOD proteins and NINJA. TIFY8 interacted with TOPLESS through NINJA and accordingly acted as a transcriptional repressor. TIFY8 expression was inversely correlated with JAZ expression during development and after infection with Pseudomonas syringae. Nevertheless, transgenic lines with altered TIFY8 expression did not show changes in JA sensitivity. Despite the functional ZIM domain, no interaction with JAZ proteins could be found. In contrast, TIFY8 was found in protein complexes involved in regulation of dephosphorylation, deubiquitination and O-linked N-acetylglucosamine modification suggesting an important role in nuclear signal transduction.

Characterization of aJAZ7activation-tagged Arabidopsis mutant with increased susceptibility to the fungal pathogenFusarium oxysporum

“…The ZIM domain of JAZ proteins mediates their homo- or heterodimerization ( Chini et al , 2009 ; Chung and Howe, 2009 ; Chung et al , 2009 ), but JAZ7 appears to be the only JAZ protein incapable of homodimerizing or forming heterodimers with other JAZ proteins ( Chini et al , 2009 ; Chung and Howe, 2009 ; reviewed by Pauwels and Goossens, 2011 ). Another TIFY-containing protein not capable of interacting with JAZ proteins is the non-JAZ protein TIFY8 ( Cuéllar Pérez et al , 2014 ). Although TIFY8 has a functional ZIM domain that mediates transcriptional repression by recruiting TPL via NINJA, its ZIM domain does not confer interactions with JAZ proteins.…”

The Agrobacterium tumefaciens virulence protein VirE3 is a transcriptional activator of the F‐box gene VBF

“…For the construction of pART7RFP‐virE3 (pSDM4508), the RFP ORF was amplified by PCR with the primer set 5′‐GGGGTACCATGGCCTCCTCCGAGGACGTC‐3′ and 5′‐TATGGATCCGGCGCCGGTGGAGTGGCGGCC‐3′ on pART7‐RFP (pSDM4336) and cloned into pJET1.2, then the RFP ORF was excised from pJET1,2‐RFP with Kpn I/ Bam HI and cloned into pART7YFP‐virE3 digested with Kpn I/ Bam HI to generate pART7RFP‐virE3. The TIFY8 protein was used as a nuclear marker (Cuéllar Pérez et al ., ); to this end the TIFY8 ORF was amplified by PCR with the primer set 5′‐GCGTCGACAATGATGGTGAACCACAACAATG‐3′ and 5′‐GCGTCGACTGTGGCTTCTTTTTCAGGATC‐3′ and cloned into pTH2 digested with Sal I to generate a construct encoding the TFY8–GFP fusion protein (pSDM4509). The plasmid with the plastid‐mCherry (CD3‐1000) marker was previously described (Nelson et al ., ).…”

Isolation of protein complexes from the model legume Medicago truncatula by tandem affinity purification in hairy root cultures

“…The JAZ proteins belong to the TIFY protein family, which, besides 12 JAZ proteins, also comprises TIFY8 and the two PEAPOD (PPD) proteins in Arabidopsis, all of which can interact with the Arabidopsis NINJA (Pauwels et al ., ; Pauwels and Goossens, ; Cuéllar Pérez et al ., ). To assess whether MtNINJA displayed similar protein affinities, we first mined the M. truncatula genome for homologues of JAZ, PPD and TIFY8.…”