The mTORC1/4E-BP1 axis represents a critical signaling node during fibrogenesis

Woodcock, Hannah V; Eley, Jessica D.; Guillotin, Delphine; Platé, Manuela; Nanthakumar, Carmel B.; Martufi, Matteo; Peace, Simon; Joberty, Gérard; Poeckel, Daniel; Good, Robert B.; Taylor, Adam; Zinn, Nico; Redding, Matthew; Forty, Ellen; Hynds, Robert E.; Swanton, Charles; Karsdal, Morten A.; Maher, Toby M.; Fisher, Andrew J.; Bergamini, Giovanna; Marshall, Richard P.; Blanchard, Andy; Mercer, Paul F.; Chambers, Rachel C.

doi:10.1038/s41467-018-07858-8

Cited by 171 publications

(170 citation statements)

References 49 publications

Supporting

Mentioning

159

Contrasting

Order By: Relevance

“…The observation that the collagen eigengene network also comprised a small TSC2/RHEB module, a prominent intrinsic regulator of mTORC1 activity, was of particular interest in light of the recent evidence highlighting a key role for the mTORC1/4E-BP1 axis as a core fibrogenic pathway downstream of TGF-β1. [14] The current LCM FF transcriptome and our previously published RNASeq dataset of TGF-β1-stimulated pHLFs, further revealed that RHEB was positively correlated with the collagen eigengene , whereas TSC2 was inversely correlated, supporting a potential model of persistent mTORC1 activation. The specific mechanism by which TGF-β1 promotes the activation of mTORC1 remains poorly understood and it is also recognised that the TSC2/RHEB signalling can act independently of mTORC1.…”

Section: Discussionmentioning

confidence: 60%

“…Control and IPF pHLFs (REC reference 12/EM/0058) and CAFs from lung adenocarcinoma (via the Tracking Cancer Evolution through Therapy (TRACERx) clinical study, REC reference 13/LO/1546) were grown from explant cultures as previously described. [14] Primary adult HSCs were obtained from Zen-Bio (#HP-F-S). RNAseq was performed on control pHLFs as described in [15] (GSE102674).…”

Section: Methodsmentioning

confidence: 99%

“…RNAseq was performed on control pHLFs as described in [15] (GSE102674). CRISPR-Cas9 gene editing followed the protocol described in [14] using a guide RNA sequence targeting RHEB (AGATGCCGCAGTCCAAGTCCCGG). Protein phosphorylation and expression were assessed by western blotting as described in [14] using p-4EBP1 (#13443), p-P70S6K (#9234), 4EBP1 (#9644), P70S6K (#9202) and RHEB (#13879) antibodies (all from Cell Signalling).…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

Transcriptome analysis of IPF fibroblastic foci identifies key pathways involved in fibrogenesis

Guillotin

Taylor

Platé

et al. 2020

Preprint

Self Cite

View full text Add to dashboard Cite

Fibroblastic foci (FF) represent the cardinal pathogenic lesion in idiopathic pulmonary fibrosis (IPF) and comprise activated fibroblasts and myofibroblasts, the key effector cells responsible for dysregulated extracellular matrix deposition in multiple fibrotic conditions. The aim of this study was to define the major transcriptional programmes involved in fibrogenesis in IPF by profiling un-manipulated myo/fibroblasts within FF in situ by laser capture microdissection.The challenges associated with deriving gene calls from low amounts of RNA and the absence of a meaningful comparator cell type were overcome by adopting novel data mining strategies and by using weighted gene co-expression network analysis (WGCNA), as well as an eigengene-based approach to identify transcriptional signatures which correlate with fibrillar collagen gene expression. WGCNA identified prominent clusters of genes associated with cell cycle, inflammation/differentiation, translation and cytoskeleton/cell adhesion. Collagen eigengene analysis revealed that TGF-β1, RhoA kinase and the TSC2/RHEB axis formed major signalling clusters associated with collagen gene expression. Functional studies using CRISPR-Cas9 gene edited cells demonstrated a key role for the TSC2/RHEB axis in regulating TGF-β1-induced mTORC1 activation and collagen I deposition in mesenchymal cells reflecting IPF and other disease settings, including cancer-associated fibroblasts. These data provide strong support for the human tissue-based and bioinformatics approaches adopted to identify critical transcriptional nodes associated with the key pathogenic cell responsible for fibrogenesis in situ and further identifies the TSC2/RHEB axis as a potential novel target for interfering with excessive matrix deposition in IPF and other fibrotic conditions.What is the key question?Can we identify a transcriptional signature associated with collagen gene expression in the fibrotic focus, the cardinal fibrotic lesion in IPF?What is the bottom line?We herein define the major transcriptional programmes involved in fibrogenesis in IPF by profiling myo/fibroblasts within FF in situ by laser capture microdissection.Why read on?The data provide strong support for a human tissue-based approach to identify critical transcriptional nodes associated with fibrogenesis in situ and further identifies the TSC2/RHEB axis as a potential novel target for interfering with excessive matrix deposition in IPF and other fibrotic conditions.

show abstract

Section: Discussionmentioning

confidence: 60%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Transcriptome analysis of IPF fibroblastic foci identifies key pathways involved in fibrogenesis

Guillotin

Taylor

Platé

et al. 2020

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

“…The IPF susceptibility risk allele at this locus was associated with decreased gene expression of DEPTOR in lung tissue. TGF-induced DEPTOR suppression can stimulate collagen synthesis 38 and the importance of mTORC1 signalling via 4E-BP1 for TGFβ induced collagen synthesis has recently been demonstrated in fibrogenesis 39 . The signal on chromosome 8 did also colocalise with expression of TAF2, RP11-760H22.2 and KB-1471A8.1 in similar tissues to DEPTOR.…”

Section: Discussionmentioning

confidence: 99%

Genome-wide association study of susceptibility to idiopathic pulmonary fibrosis

Guillén‐Guío

Oldham

et al. 2019

Preprint

View full text Add to dashboard Cite

Rationale: Idiopathic pulmonary fibrosis (IPF) is a complex lung disease characterised by scarring of the lung that is believed to result from an atypical response to injury of the epithelium. The mechanisms by which this arises are poorly understood and it is likely that multiple pathways are involved. The strongest genetic association with IPF is a variant in the promoter of MUC5B where each copy of the risk allele confers a five-fold risk of disease. However, genome-wide association studies have reported additional signals of association implicating multiple pathways including host defence, telomere maintenance, signalling and cell-cell adhesion. Objectives:To improve our understanding of mechanisms that increase IPF susceptibility by identifying previously unreported genetic associations. Methods and measurements:We performed the largest genome-wide association study undertaken for IPF susceptibility with a discovery stage comprising up to 2,668 IPF cases and 8,591 controls with replication in an additional 1,467 IPF cases and 11,874 controls. Polygenic risk scores were used to assess the collective effect of variants not reported as associated with IPF. Main results:We identified and replicated three new genome-wide significant (P<5×10 −8 ) signals of association with IPF susceptibility (near KIF15, MAD1L1 and DEPTOR) and confirm associations at 11 previously reported loci. Polygenic risk score analyses showed that the combined effect of many thousands of as-yet unreported IPF risk variants contribute to IPF susceptibility. Conclusions:Novel association signals support the importance of mTOR signalling in lung fibrosis and suggest a possible role of mitotic spindle-assembly genes in IPF susceptibility.

show abstract

“…Herein, we avoided this loss-of-function by utilizing a biocatalyst, lipase B, to direct conjugation to a site known not to interrupt protein binding. We utilized porcine fibroblasts as a model-mTOR pathway system, as fibroblasts have been shown to highly depend on mTOR for migration, proliferation, and survival [25,26]. Using a wound-healing "scratch" assay as a measure of mTOR activity (Figure 8) we found no significant differences in drug activity between RAP and RAP-Ad, while "Dimeric" RAP seemed to have diminished activity at lower concentrations (< 2 uM).…”

Section: Rapamycin Retains Its Biofunctionality After Selective Modifmentioning

confidence: 95%

Engineering Selective Molecular Tethers to Enhance Suboptimal Drug Properties

Dogan

Recum

2020

Preprint

View full text Add to dashboard Cite

Small-molecule drugs are utilized in a wide variety of clinical applications, however, many of these drugs suffer from one or more suboptimal property that can hinder its delivery or cellular action in vivo, or even shelf an otherwise biologically tolerable drug. While high-throughput screening provides a method to discover drugs with altered chemical properties, directly engineering small-molecule bioconjugates provides an opportunity to specifically modulate drug properties rather than sifting through large drug libraries with seemingly 'random' drug properties. Herein, we propose that selectively "tethering" a drug molecule to an additional group with favorable properties will improve the drug conjugate's overall properties, such as solubility. Specifically, we outlined the site-specific chemical conjugation of rapamycin (RAP) to an additional "high-affinity" group to increase the overall affinity the drug has for cyclodextrin-based polymers (pCD). By doing so, we found that RAP's affinity for pCD and RAP's window of delivery from pCD microparticles was tripled without sacrificing RAP's cellular action. This synthesis method was applied to the concept of "affinity" for pCD, but other prosthetic groups can be used in a similar manner to modify other drug properties. This study displays potential for increasing drug delivery windows of small-molecule drugs in pCD systems for chronic drug therapies and introduces the idea of altering drug properties to tune polymerdrug interactions.

show abstract

The mTORC1/4E-BP1 axis represents a critical signaling node during fibrogenesis

Cited by 171 publications

References 49 publications

Transcriptome analysis of IPF fibroblastic foci identifies key pathways involved in fibrogenesis

Transcriptome analysis of IPF fibroblastic foci identifies key pathways involved in fibrogenesis

Genome-wide association study of susceptibility to idiopathic pulmonary fibrosis

Engineering Selective Molecular Tethers to Enhance Suboptimal Drug Properties

Contact Info

Product

Resources

About