The Mre11-Rad50-Nbs1 Complex Acts Both Upstream and Downstream of Ataxia Telangiectasia Mutated and Rad3-related Protein (ATR) to Regulate the S-phase Checkpoint following UV Treatment

Abstract

The Mre11-Rad50-Nbs1 (MRN) complex is required for mediating the S-phase checkpoint following UV treatment, but the underlying mechanism is not clear. Here we demonstrate that at least two mechanisms are involved in regulating the S-phase checkpoint in an MRN-dependent manner following UV treatment. First, when replication forks are stalled, MRN is required upstream of ataxia telangiectasia mutated and Rad3-related protein (ATR) to facilitate ATR activation in a substrateand dosage-dependent manner. In particular, MRN is required for ATR-directed phosphorylation of RPA2, a critical event in mediating the S-phase checkpoint following UV treatment. Second, MRN is a downstream substrate of ATR. Nbs1 is phosphorylated by ATR at Ser-343 when replication forks are stalled, and this phosphorylation event is also important for down-regulating DNA replication following UV treatment. Moreover, we demonstrate that MRN and ATR/ATR-interacting protein (TRIP) interact with each other, and the forkhead-associated/ breast cancer C-terminal domains (FHA/BRCT) of Nbs1 play a significant role in mediating this interaction. Mutations in the FHA/BRCT domains do not prevent ATR activation but specifically impair ATR-mediated Nbs1 phosphorylation at Ser-343, which results in a defect in the S-phase checkpoint. These data suggest that MRN plays critical roles both upstream and downstream of ATR to regulate the S-phase checkpoint when replication forks are stalled.

Cleavage of the BRCT tandem domains of nibrin by the 657del5 mutation affects the DNA damage response less than the Arg215Trp mutation

“…Similarly, also in NBS cells homozygous for the 657del5 mutation, the impairment of ATM, SMC1, and p53 phosphorylation has been observed, even if at a lower degree when compared to R215W cells. These data can be explained considering that NBN acts in both the ATM-and the ataxia-telangiectasia and Rad3-related protein (ATR)-dependent signaling (52). Although ATM responds to the presence of DSBs, ATR appears to be activated by single-stranded DNA, arising at stalled replication forks or generated during processing of bulky lesions (53,54).…”

ATM Protein-dependent Phosphorylation of Rad50 Protein Regulates DNA Repair and Cell Cycle Control

“…These models suggest that NBN acts as a multimodal adaptor linking the MRN complex to ATM and several other proteins involved in the response to DNA DSB (78). Its function is attenuated by phosphorylation in controlling the S-phase checkpoint (44,63,64) in the down-regulation of DNA replication after UV exposure (79) and in mediating ATR-dependent replication protein A1 hyperphosphorylation during replication fork stalling (80). Although not demonstrated, it seems likely that NBN Ser(P)-343 leads to conformational change that alters the function or interaction of the sub- units of MRN at the site of the DNA DSB.…”

The RING Finger Protein RNF8 Ubiquitinates Nbs1 to Promote DNA Double-strand Break Repair by Homologous Recombination

“…The shRNA target sequences for Mre11 and Nbs1 were previously described (45), and the following shRNAs were designed by Dharmacon: for RNF8sh GGACAAUUAUGGACAA-CAAGA; for MDC1sh GUCUCCCAGAAGACAGUGAUU; and for H2AXsh GGGACGAAGCACUUGGUAA. Enhanced blue fluorescence protein (EBFP)-marked shRNAs were generated by replacing the puromycin marker of pMKO-puro with EBFP-puromycin fusion protein (EBFP obtained from Addgene plasmid 14983 (46)), followed by retroviral infection and puromycin selection.…”