The mouse ortholog of NEIL3 is a functional DNA glycosylase in vitro and in vivo

Abstract

To protect cells from oxidative DNA damage and mutagenesis, organisms possess multiple glycosylases to recognize the damaged bases and to initiate the Base Excision Repair pathway. Three DNA glycosylases have been identified in mammals that are homologous to the Escherichia coli Fpg and Nei proteins, Neil1, Neil2, and Neil3. Neil1 and Neil2 in human and mouse have been well characterized while the properties of the Neil3 protein remain to be elucidated. In this study, we report the characterization of Mus musculus (house mouse) Neil3 (MmuNeil3) as an active DNA glycosylase both in vitro and in vivo. In duplex DNA, MmuNeil3 recognizes the oxidized purines, spiroiminodihydantoin (Sp), guanidinohydantoin (Gh), 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyG) and 4,6-diamino-5-formamidopyrimidine (FapyA), but not 8-oxo-7,8-dihydroguanine (8-oxoG). Interestingly, MmuNeil3 prefers lesions in single-stranded DNA and in bubble structures. In contrast to other members of the family that use the N-terminal proline as the nucleophile, MmuNeil3 forms a Schiff base intermediate via its N-terminal valine. We expressed the glycosylase domain of MmuNeil3 (MmuNeil3Δ324) in an Escherichia coli triple mutant lacking Fpg, Nei, and MutY glycosylase activities and showed that MmuNeil3 greatly reduced both the spontaneous mutation frequency and the level of FapyG in the DNA, suggesting that Neil3 plays a role in repairing FapyG in vivo.base excision repair | endonuclease VIII Like 3 | 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyG) | Spiroiminodihydantoin D NA glycosylases play an important role in maintaining genomic integrity by recognizing various nonhelix distorting base lesions created by ionizing radiation, alkylating, or oxidizing agents, which are often cytotoxic or mutagenic (1). DNA glycosylases cleave the N-glycosylic bond and release the base lesion from the sugar backbone, resulting in an apurinic or apyrimidinic (AP) site (2). Besides glycosylase activity, some of these enzymes also have a lyase activity to process the AP site. In this way, DNA glycosylases initiate the Base Excision Repair (BER) † pathway and create the substrates for further processing by a series of BER enzymes including phosphodiesterases, AP endonucleases, DNA polymerases, and DNA ligases to complete lesion repair (3).DNA glycosylases that recognize oxidized bases can be divided into two families based on structure and sequence homology (4, 5), the Nth family, whose members are widely distributed in bacteria, archaea, and eukaryotes (5), and the Fpg/Nei family, which is more sparsely distributed across phyla. Fpg/Nei family members are characterized by a signature helix-two turns-helix (H2TH) motif and a zinc finger (or "zincless finger") motif for DNA binding; they also have a conserved N terminus harboring a proline residue (P2) important for catalysis (6). In Escherichia coli, formamidopyrimidine DNA glycosylase (EcoFpg) mainly recognizes oxidized purines (7), and endonuclease VIII (EcoNei) mainly recognizes oxidized pyrimidines and adenin...

Oxidative DNA damage in disease—Insights gained from base excision repair glycosylase‐deficient mouse models

“…Mouse NEIL3 has been shown to have broad substrate recognition, which includes the further oxidation products of 8-oxoG, Sp, and Gh, but not 8-oxoG itself. NEIL3 has also been shown to recognize Tg, FapyG, and FapyA lesions [Liu et al, 2010]. Some recent insights from a NEIL3-deficient mouse model suggesting a role for NEIL3 in neuronal health are discussed in the section on neurodegeneration, below.…”

Post-hypoxic hypothermia is protective in human NT2-N neurons regardless of oxygen concentration during reoxygenation

“…and NEIL1 (Nei-like DNA glycosylase 1) 68 . Some repair ability has been reported also for NEIL3 69,70 , which is otherwise suggested to be more important for neurogenesis than for classical DNA repair [71][72][73][74] . The mechanisms for regulation of base excision repair after neuronal injury are not well understood.…”

“…Sense Antisense IL-12p40 CCAGTACACCTGTCGCAAAGG AGCTCTTGTTTTTGGGCTCTTTCT IL-8 CAGCTCTCTGTGAGGCTGCA GGAAAGGTGTGGAATGCGTATT IL-1b AGTGATGGCTAACTACGGTGACAA CTCCCATTTCTCAGAGAACCAAG IL-6 AATGAGAAAGGAGATGTGTGAGAAGTAT TGGAAGGTTCAGGTTGTTTTCTG TNF-a CAAGGACTCAGATCATCGTCTCA CATACCCACTCTGCCATTGGA TLR-2 CCCATCAGGCTTCTTCTCTGTCT ACATAGGCGATCCTGTTATTGGA TLR-4 CAGAGCCGATGGTGTATCTTTG GCAGCAGGGACTTCTCCAACT (70). All cytokine values below the detection limit were set to zero.…”

Neil3 and NEIL1 DNA Glycosylases Remove Oxidative Damages from Quadruplex DNA and Exhibit Preferences for Lesions in the Telomeric Sequence Context

“…Glycosylase Activity Assay-Enzymes and substrates were incubated at 37°C in various glycosylase assay buffers as described previously (13). To measure the glycosylase activity only, reactions were terminated by adding NaOH to a final concentration of 0.33 N, and samples were immediately put on ice.…”

“…For example, the mammalian glycosylases OGG1 and NTH1 specifically remove oxidized purines and pyrimidines, respectively, from duplex DNA (10). NEIL1, NEIL2, and NEIL3 prefer oxidized pyrimidine and some purine damages (11,12), with NEIL2 and NEIL3 preferring lesions in single-stranded DNA (13)(14)(15).…”