The molecular role of Sigmar1 in regulating mitochondrial function through mitochondrial localization in cardiomyocytes

Abdullah, Chowdhury S.; Aishwarya, Richa; Alam, Shafiul; Remex, Naznin Sultana; Morshed, Mahboob; Nitu, Sadia; Miriyala, Sumitra; Panchatcharam, Manikandan; Hartman, Brandon; King, Judy A.; Bhuiyan, Mohammad Alfrad Nobel; Traylor, James; Kevil, Christopher G.; Orr, A. Wayne; Bhuiyan, Shenuarin

doi:10.1016/j.mito.2021.12.002

Cited by 8 publications

(9 citation statements)

References 87 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Our TEM images also showed altered elongated mitochondrial shape and structure in Sigmar1 −/− mice lungs compared to Wt. This finding is consistent with previous studies identifying Sigmar1’s mitochondrial localization and Sigmar1-mediated regulation of mitochondrial function, dynamics, and respiration ( Fukunaga et al, 2015 ; Abdullah et al, 2018 ; Abdullah et al, 2022 ).…”

Section: Discussionsupporting

confidence: 93%

Sigmar1 ablation leads to lung pathological changes associated with pulmonary fibrosis, inflammation, and altered surfactant proteins levels

et al. 2023

Self Cite

View full text Add to dashboard Cite

Sigma1 receptor protein (Sigmar1) is a small, multifunctional molecular chaperone protein ubiquitously expressed in almost all body tissues. This protein has previously shown its cardioprotective roles in rodent models of cardiac hypertrophy, heart failure, and ischemia-reperfusion injury. Extensive literature also suggested its protective functions in several central nervous system disorders. Sigmar1’s molecular functions in the pulmonary system remained unknown. Therefore, we aimed to determine the expression of Sigmar1 in the lungs. We also examined whether Sigmar1 ablation results in histological, ultrastructural, and biochemical changes associated with lung pathology over aging in mice. In the current study, we first confirmed the presence of Sigmar1 protein in human and mouse lungs using immunohistochemistry and immunostaining. We used the Sigmar1 global knockout mouse (Sigmar1−/−) to determine the pathophysiological role of Sigmar1 in lungs over aging. The histological staining of lung sections showed altered alveolar structures, higher immune cells infiltration, and upregulation of inflammatory markers (such as pNFκB) in Sigmar1−/− mice compared to wildtype (Wt) littermate control mice (Wt). This indicates higher pulmonary inflammation resulting from Sigmar1 deficiency in mice, which was associated with increased pulmonary fibrosis. The protein levels of some fibrotic markers, fibronectin, and pSMAD2 Ser 245/250/255 and Ser 465/467, were also elevated in mice lungs in the absence of Sigmar1 compared to Wt. The ultrastructural analysis of lungs in Wt mice showed numerous multilamellar bodies of different sizes with densely packed lipid lamellae and mitochondria with a dark matrix and dense cristae. In contrast, the Sigmar1−/− mice lung tissues showed altered multilamellar body structures in alveolar epithelial type-II pneumocytes with partial loss of lipid lamellae structures in the lamellar bodies. This was further associated with higher protein levels of all four surfactant proteins, SFTP-A, SFTP-B, SFTP-C, and SFTP-D, in the Sigmar1−/− mice lungs. This is the first study showing Sigmar1’s expression pattern in human and mouse lungs and its association with lung pathophysiology. Our findings suggest that Sigmar1 deficiency leads to increased pulmonary inflammation, higher pulmonary fibrosis, alterations of the multilamellar body stuructures, and elevated levels of lung surfactant proteins.

show abstract

Section: Discussionsupporting

confidence: 93%

Sigmar1 ablation leads to lung pathological changes associated with pulmonary fibrosis, inflammation, and altered surfactant proteins levels

et al. 2023

Self Cite

View full text Add to dashboard Cite

show abstract

“…The presence of Sigmar1 in the mitochondria was first identified by Klouz et al, 2002 in 2002 in the liver tissue section using colocalization of Sigmar1 with a mitochondrial marker. Recent studies confirmed Sigmar1’s localization in the mitochondria of cardiomyocytes using quantum dot-mediated immunolabeling of Sigmar1 using transmission electron microscopy (TEM), co-immunostaining with mitochondria-specific MitoTracker, and using subcellular fractionation assays ( Abdullah et al, 2022a ; Aishwarya et al, 2022a ). Thus, Sigmar1 has a potential role in regulating mitochondrial respiration and bioenergetics that is essential to continue important cellular functions.…”

Section: Introductionmentioning

confidence: 90%

Deletion of Sigmar1 leads to increased arterial stiffness and altered mitochondrial respiration resulting in vascular dysfunction

Remex,

Abdullah,

Aishwarya

et al. 2024

Front. Physiol.

Self Cite

View full text Add to dashboard Cite

Sigmar1 is a ubiquitously expressed, multifunctional protein known for its cardioprotective roles in cardiovascular diseases. While accumulating evidence indicate a critical role of Sigmar1 in cardiac biology, its physiological function in the vasculature remains unknown. In this study, we characterized the expression of Sigmar1 in the vascular wall and assessed its physiological function in the vascular system using global Sigmar1 knockout (Sigmar1−/−) mice. We determined the expression of Sigmar1 in the vascular tissue using immunostaining and biochemical experiments in both human and mouse blood vessels. Deletion of Sigmar1 globally in mice (Sigmar1−/−) led to blood vessel wall reorganizations characterized by nuclei disarray of vascular smooth muscle cells, altered organizations of elastic lamina, and higher collagen fibers deposition in and around the arteries compared to wildtype littermate controls (Wt). Vascular function was assessed in mice using non-invasive time-transit method of aortic stiffness measurement and flow-mediated dilation (FMD) of the left femoral artery. Sigmar1−/− mice showed a notable increase in arterial stiffness in the abdominal aorta and failed to increase the vessel diameter in response to reactive-hyperemia compared to Wt. This was consistent with reduced plasma and tissue nitric-oxide bioavailability (NOx) and decreased phosphorylation of endothelial nitric oxide synthase (eNOS) in the aorta of Sigmar1−/− mice. Ultrastructural analysis by transmission electron microscopy (TEM) of aorta sections showed accumulation of elongated shaped mitochondria in both vascular smooth muscle and endothelial cells of Sigmar1−/− mice. In accordance, decreased mitochondrial respirometry parameters were found in ex-vivo aortic rings from Sigmar1 deficient mice compared to Wt controls. These data indicate a potential role of Sigmar1 in maintaining vascular homeostasis.

show abstract

“…Primary neonatal rat ventricular cardiomyocytes (NRCs) were isolated from 1- to 2-day old Sprague-Dawley rat pups [ 23 , 40 , [44] , [45] , [46] ]. The dissected rat pup heart ventricles were subjected to sequential enzymatic digestion with collagenase II (Worthington) and Trypsin (Gibco).…”

Section: Methodsmentioning

confidence: 99%

“…To genetically knockdown of Atg7, cardiomyocytes were transfected with Atg7 siRNA (CCAGUCUGUUGAAGUUCUCUGCUUU and AAAGCAGAGAACUUCAACAGACUGG; Invitrogen) using Lipofectamine 2000 (Invitrogen) in Opti-MEM reduced serum medium (Invitrogen) for 16 h [ 23 , [45] , [46] , [47] ]. After 16 h of incubation, media were changed to regular culture media containing 2% FBS [ 23 , [45] , [46] , [47] ]. A non-specific siRNA was used as a negative control in all gene silencing experiments.…”

Section: Methodsmentioning

confidence: 99%

“…Rat left ventricular heart tissues and neonatal rat cardiomyocytes (NRCs) were lysed with ice-cold Cell Lytic M buffer (Sigma-Aldrich) containing 1x Halt protease and phosphatase inhibitor cocktail (Invitrogen) [ 23 , 40 , 44 , 45 , 47 , 48 ]. The lysed cell materials were sonicated briefly followed by centrifugation at 14,000× g for 15 min to precipitate insoluble cell debris.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Mitochondrial dysfunction and autophagy activation are associated with cardiomyopathy developed by extended methamphetamine self-administration in rats

Abdullah¹,

Remex²,

Aishwarya³

et al. 2022

Redox Biology

Self Cite

View full text Add to dashboard Cite

The molecular role of Sigmar1 in regulating mitochondrial function through mitochondrial localization in cardiomyocytes

Cited by 8 publications

References 87 publications

Sigmar1 ablation leads to lung pathological changes associated with pulmonary fibrosis, inflammation, and altered surfactant proteins levels

Sigmar1 ablation leads to lung pathological changes associated with pulmonary fibrosis, inflammation, and altered surfactant proteins levels

Deletion of Sigmar1 leads to increased arterial stiffness and altered mitochondrial respiration resulting in vascular dysfunction

Mitochondrial dysfunction and autophagy activation are associated with cardiomyopathy developed by extended methamphetamine self-administration in rats

Contact Info

Product

Resources

About