The metabolic regulator PGC-1α links hepatitis C virus infection to hepatic insulin resistance

Shlomai, Amir; Rechtman, Maya Mouler; Burdelova, Ela; Zilberberg, Alona; Hoffman, Seymour; Solar, Irit; Fishman, Sigal; Halpern, Zamir; Sklan, Ella H.

doi:10.1016/j.jhep.2012.06.021

Cited by 32 publications

(33 citation statements)

References 36 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Oxidative stress induced by HCV replication is reportedly responsible for the increased HNF4␣ activity in Huh.8 cells (22). In addition, HCV infection enhances the activities of peroxisome proliferator-activated receptor-␥ coactivator 1␣ (PGC-1␣) (46) and CREB-binding protein (47), which work as coactivators of HNF4␣ to promote HNF4␣ activity.…”

Section: Discussionmentioning

confidence: 99%

Hepatocyte Nuclear Factor 4α and Downstream Secreted Phospholipase A ₂ GXIIB Regulate Production of Infectious Hepatitis C Virus

Jiang

et al. 2014

J Virol

View full text Add to dashboard Cite

Hepatitis C virus (HCV) is a major cause of chronic hepatitis, liver cirrhosis, and hepatocellular carcinoma in humans. The life cycle of HCV is closely associated with the metabolism of lipids, especially very-low-density lipoprotein (VLDL) in hepatocytes. Hepatocyte nuclear factor 4␣ (HNF4␣), the most abundant transcription factor in the liver, regulates the VLDL secretory pathway. However, the effects of HNF4␣ on the HCV life cycle are unclear. In this study, we investigated the regulatory effects of HNF4␣ on HCV assembly and secretion. HCV in HNF4␣-deficient hepatocytes showed reduced assembly and secretion but unchanged entry and RNA replication. Bezafibrate, a chemical inhibitor of HNF4␣, suppressed HCV assembly and secretion. HNF4␣ downregulation resulted in rearrangement of cytosolic lipid droplets (LDs), as evidenced by the aggregation of large LDs and distorted cytosolic distribution. Phospholipase A 2 GXIIB (PLA 2 GXIIB), an HNF4␣-regulated factor involved in VLDL secretion, was found to be crucial in HCV secretion. PLA 2 GXIIB expression was upregulated in hepatocytes harboring HCV subgenomic replicons or in HCV-infected hepatocytes. This upregulation was transcriptionally controlled in an HNF4␣-dependent manner after HCV infection. Furthermore, PLA 2 GXIIB combined with microsomal triglyceride transfer protein was found to be responsible for the regulation of HNF4␣-induced HCV infectivity. These results suggest that HNF4␣ and its downstream PLA 2 GXIIB are important factors affecting the late stage of the HCV life cycle and may serve as potential drug targets for the treatment of HCV infection. IMPORTANCEThe assembly and secretion of hepatitis C virus (HCV) are closely correlated with the very-low-density lipoprotein (VLDL) secretory pathway. However, the molecular mechanism by which HCV cooperates with VLDL to facilitate assembly and release is unclear. In this study, we report the function of hepatocyte nuclear factor 4␣ (HNF4␣), the most abundant liver-enriched transcription factor, in HCV assembly and release. HNF4␣ is crucial in VLDL-mediated lipid transport. We found that HNF4␣ abundance was increased upon HCV infection and that HNF4␣ downregulation impaired the assembly and secretion of HCV. We also determined that PLA 2 GXIIB, a direct target factor of HNF4␣ involved in VLDL secretion, was upregulated upon HCV infection. These results suggest that PLA 2 GXIIB is required in the late stage of the HCV life cycle and that the VLDL secretory pathway is important for HCV assembly and secretion. This study provides insights into the mechanism by which HCV cooperates with HNF4␣ to be assembled into and released together with VLDL particles.

show abstract

Section: Discussionmentioning

confidence: 99%

Hepatocyte Nuclear Factor 4α and Downstream Secreted Phospholipase A ₂ GXIIB Regulate Production of Infectious Hepatitis C Virus

Jiang

et al. 2014

J Virol

View full text Add to dashboard Cite

show abstract

“…It predisposes the infected to both type 1 diabetes mellitus (T1DM) and T2DM (Antonelli et al 2014). PGC-1α expression is dramatically elevated in HCV-infected cells, accompanied by an upregulated expression of PEPCK and G6Pase (Qadri et al 2012, Shlomai et al 2012. In addition, the HCV nonstructural protein 5A induces metabolic dysregulation and IR in human hepatoma cells, in which PGC-1α could be involved (Parvaiz et al 2014).…”

Section: Hepatitis C Virusmentioning

confidence: 99%

“…In addition, oxidative stress and endoplasmic reticulum (ER) stress are also responsible for the association of HCV with diabetes mellitus. Treatment of HCV replicon cells with the antioxidant N-acetylcysteine can attenuate the PGC-1α expression induced by HCV, suggesting that HCV-promoted PGC-1α induction is mediated by oxidative stress and inflammation (Shlomai et al 2012). In addition, a recent study has reported that HCV infection induces PGC-1α expression and ER stress.…”

Section: Hepatitis C Virusmentioning

confidence: 99%

PGC-1α, glucose metabolism and type 2 diabetes mellitus

Deng

Shi

et al. 2016

Journal of Endocrinology

125

View full text Add to dashboard Cite

Type 2 diabetes mellitus (T2DM) is a chronic disease characterized by glucose metabolic disturbance. A number of transcription factors and coactivators are involved in this process. Peroxisome proliferator-activated receptor gamma coactivator 1 alpha (PGC-1α) is an important transcription coactivator regulating cellular energy metabolism. Accumulating evidence has indicated that PGC-1α is involved in the regulation of T2DM. Therefore, a better understanding of the roles of PGC-1α may shed light on more efficient therapeutic strategies. Here, we review the most recent progress on PGC-1α and discuss its regulatory network in major glucose metabolic tissues such as the liver, skeletal muscle, pancreas and kidney. The significant associations between PGC-1α polymorphisms and T2DM are also discussed in this review.

show abstract

“…pRlenti was also used to generate the expression plasmids L-PGC-1␣ and WT-PGC-1␣ with HA tags at the N terminus. To express short hairpin RNA (shRNA) targeting WT-PGC-1␣/L-PGC-1␣, we used the pSuper retroviral plasmid that was created as described in reference 23 by using the following primers: for shPGC-1␣ 1#, 5=-GATC CCCCCAACACTCAGCTAAGTTATTCAAGAGATAACTTAGCTGAGT GTTGGTTTTTA-3= and 5=-AGCTTAAAAACCAACACTCAGCTAAGT TATCTCTTGAATAACTTAGCTGAGTGTTGGGGG-3= (20), and for shPGC-1␣ 2#, 5=-GATCCCCCCGTTATACCTGTGATGCTTTTTCAAG AGAAAAGCATCACAGGTATAACGGTTTTTA-3= and 5=-AGCTTAAA AACCGTTATACCTGTGATGCTTTTCTCTTGAAAAAGCATCACAGGT ATAACGGGGG-3=.…”

Section: Methodsmentioning

confidence: 99%

“…Shlomai et al (20) showed that WT-PGC-1␣ is robustly upregulated by HCV infection and that elevated WT-PGC-1␣ links HCV infection to hepatic IR. However, the effect of HCV infection on L-PGC-1␣ expression remains unknown, and the mechanism by which HCV infection modulates WT-PGC-1␣/L-PGC-1␣ remains unclear.…”

mentioning

confidence: 99%

Endoplasmic Reticulum Stress Links Hepatitis C Virus RNA Replication to Wild-Type PGC-1α/Liver-Specific PGC-1α Upregulation

Yao

Cai

et al. 2014

J Virol

View full text Add to dashboard Cite

Hepatitis C virus (HCV) causes not only severe liver problems but also extrahepatic manifestations, such as insulin resistance (IR). Wild-type peroxisome proliferator-activated receptor gamma coactivator 1 alpha (WT-PGC-1␣) is essential in hepatic gluconeogenesis and has recently been demonstrated to link HCV infection to hepatic insulin resistance (IR). A recent study has characterized a novel human liver-specific PGC-1␣ (L-PGC-1␣) transcript, which is proposed to reflect human adaption to more complex pathways. However, the effect of HCV infection on L-PGC-1␣ expression and the mechanism by which HCV modulates WT-PGC-1␣/L-PGC-1␣ remain unclear. In this study, we showed that HCV infection upregulated both WT-PGC-1␣ and L-PGC-1␣, which further promoted HCV production. The upregulation of both PGC-1␣ isoforms depended on HCV RNA replication. By using promoter-luciferase reporters, kinase inhibitors, and dominant negative mutants, we further observed that the HCV-induced upregulation of WT-PGC-1␣ was mediated by the phosphorylation of cyclic AMP (cAMP)-responsive element-binding protein (CREB), whereas that of L-PGC-1␣ was mediated by CREB phosphorylation and forkhead box O1 dephosphorylation. Moreover, HCV infection induced endoplasmic reticulum (ER) stress, and pharmacological induction of ER stress upregulated WT-PGC-1␣/L-PGC-1␣ and phosphorylated CREB. In contrast, pharmacological inhibition of HCV-induced ER stress impaired WT-PGC-1␣/ L-PGC-1␣ upregulation along with decreased phosphorylated CREB. The correlation of hepatic mPGC-1␣ with ER stress was further confirmed in mice. Overall, HCV infection upregulates both WT-PGC-1␣ and L-PGC-1␣ through an ER stress-mediated, phosphorylated CREB-dependent pathway, and both PGC-1␣ isoforms promote HCV production in turn. IMPORTANCE HCV causes not only severe liver problems but also extrahepatic manifestations, such as insulin resistance (IR). As a key regulator in energy metabolism, wild-type PGC-1␣ (WT-PGC-1␣), has recently been demonstrated to link HCV infection to hepatic IR.A recent study has characterized a novel human liver-specific PGC-1␣ (L-PGC-1␣), which reflects human adaption to more complex pathways. However, the effect of HCV infection on L-PGC-1␣ expression and the mechanism by which HCV regulates WT-PGC-1␣/L-PGC-1␣ remain unclear. In this study, we showed that HCV infection upregulated both WT-PGC-1␣ and L-PGC-1␣, which further promoted HCV production. WT-PGC-1␣ upregulation was mediated by CREB phosphorylation, whereas L-PGC-1␣ upregulation was mediated by CREB phosphorylation and FoxO1 dephosphorylation. HCV-induced ER stress mediated WT-PGC-1␣/L-PGC-1␣ upregulation and CREB phosphorylation. Overall, this study provides new insights into the mechanism by which HCV upregulates WT-PGC-1␣/L-PGC-1␣ and highlights the novel intervention of HCV-ER stress-PGC-1␣ signaling for HCV therapy and HCV-induced IR therapy.

show abstract

The metabolic regulator PGC-1α links hepatitis C virus infection to hepatic insulin resistance

Cited by 32 publications

References 36 publications

Hepatocyte Nuclear Factor 4α and Downstream Secreted Phospholipase A ₂ GXIIB Regulate Production of Infectious Hepatitis C Virus

Hepatocyte Nuclear Factor 4α and Downstream Secreted Phospholipase A ₂ GXIIB Regulate Production of Infectious Hepatitis C Virus

PGC-1α, glucose metabolism and type 2 diabetes mellitus

Endoplasmic Reticulum Stress Links Hepatitis C Virus RNA Replication to Wild-Type PGC-1α/Liver-Specific PGC-1α Upregulation

Contact Info

Product

Resources

About

The metabolic regulator PGC-1α links hepatitis C virus infection to hepatic insulin resistance

Cited by 32 publications

References 36 publications

Hepatocyte Nuclear Factor 4α and Downstream Secreted Phospholipase A 2 GXIIB Regulate Production of Infectious Hepatitis C Virus

Hepatocyte Nuclear Factor 4α and Downstream Secreted Phospholipase A 2 GXIIB Regulate Production of Infectious Hepatitis C Virus

PGC-1α, glucose metabolism and type 2 diabetes mellitus

Endoplasmic Reticulum Stress Links Hepatitis C Virus RNA Replication to Wild-Type PGC-1α/Liver-Specific PGC-1α Upregulation

Contact Info

Product

Resources

About

Hepatocyte Nuclear Factor 4α and Downstream Secreted Phospholipase A ₂ GXIIB Regulate Production of Infectious Hepatitis C Virus

Hepatocyte Nuclear Factor 4α and Downstream Secreted Phospholipase A ₂ GXIIB Regulate Production of Infectious Hepatitis C Virus