The Mammalian Hairless Protein as a DNA Binding Phosphoprotein

Brook, Lemlem; Whitfield, G. Kerr; Hsieh, David; Bither, Ryan D.; Hsieh, Jui Cheng

doi:10.1002/jcb.25641

Cited by 6 publications

(10 citation statements)

References 45 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We recently demonstrated that rat Hr is a specific substrate for protein kinase C using an in vitro phosphorylation assay. We further showed using mass spectrometry that human HR is phosphorylated in intact human U87 glioblastoma cells at Ser‐416, located in a highly conserved region which partially fulfills the criteria of a PKC site [Brook et al, ]. The previously published studies by Yang et al [] utilizing human skin fibroblasts also reported this same phosphorylation site, while also revealing an additional phosphorylation site at Ser‐425.…”

Section: Hr Structure/function Studiesmentioning

confidence: 73%

“…Our results demonstrate that, in fact, HR selectively binds to a p53 response element (p53RE) of the form 5′‐AGACATGCCTAGACATGCCT‐3′ (the p53 binding core motifs are underlined), but not to response elements for NF‐kB, TCF4, or Sp1. This in vitro finding was confirmed in intact HEK293 and U87 cells using chromatin immunoprecipitation (ChIP) and primers for a portion of the GADD45α promoter containing a p53RE with the sequence 5′‐GAACATGTCT‐AAGCATGCTG‐3′ [Brook et al, ]. Taken together, these results suggest that direct DNA binding by HR may represent, at least in part, a mechanism by which HR modulates target genes for p53.…”

Section: Hr Structure/function Studiesmentioning

confidence: 79%

“…Cotransfections with p53RE reporter gene constructs confirm that rat Hr can indeed regulate p53-mediated transactivation of a reporter gene, but it also revealed that this regulation can be positive or negative depending on the promoter context. For example, a reporter linked to the GADD45a p53RE is up-regulated, whereas downregulation is seen when the same reporter gene is linked to a p21 promoter fragment containing a p53RE [Brook et al, 2017]. HR also has target genes, especially in skin, which may be regulated in a p53RE-independent manner, such as Dlx3 in the hair follicle [Kim et al, 2012].…”

Section: Histone H3k9 Demethylase Activity Of Hrmentioning

confidence: 99%

See 2 more Smart Citations

Human Hairless Protein Roles in Skin/Hair and Emerging Connections to Brain and Other Cancers

Maatough

Whitfield

Brook

et al. 2017

J of Cellular Biochemistry

Self Cite

View full text Add to dashboard Cite

The mammalian hairless protein (HR) is a 130 kDa nuclear transcription factor that is essential for proper skin and hair follicle function. Previous studies have focused on the role of HR in skin maintenance and hair cycling. However, the hairless gene (HR) is also expressed in brain and other tissues, where its role remains poorly understood. HR has been reported to contain functional domains that potentially serve in DNA binding, histone demethylation, nuclear translocation and protein-protein interactions. Indeed, HR has been shown to interact with and repress the action of the nuclear receptors for vitamin D and thyroid hormone as well as RAR-related orphan receptor alpha, possibly via recruitment of histone deacetylases. HR may also have important functions in non-skin tissues given that nearly 200 HR mutations have been identified in patients with various cancers, including prostate, breast, lung, melanoma, uterine, and glioma. This suggests that HR and/or mutants thereof have relevance to the growth and survival of cancer cells. For example, the reported intrinsic histone H3K9 demethylase activity of HR may activate dormant genes to contribute to carcinogenesis. Alternatively, the demonstrated ability of HR to interact with p53 and/or the p53 DNA response element to influence p53-regulated pathways may explain, at least in part, why many cancers express mutated HR proteins. In this review, we summarize the current knowledge of HR bioactions, how HR mutations may be contributing to alopecia as well as to cancer, and, finally, outline future directions in the study of this largely enigmatic nuclear protein.

show abstract

Section: Hr Structure/function Studiesmentioning

confidence: 73%

Section: Hr Structure/function Studiesmentioning

confidence: 79%

Section: Histone H3k9 Demethylase Activity Of Hrmentioning

confidence: 99%

See 1 more Smart Citation

Human Hairless Protein Roles in Skin/Hair and Emerging Connections to Brain and Other Cancers

Maatough

Whitfield

Brook

et al. 2017

J of Cellular Biochemistry

Self Cite

View full text Add to dashboard Cite

show abstract

“…Our previous work demonstrated that HR protein binds to p53RE elements associated with several p53REgulated genes (eg, GADD45A and CDKN1A ) . Herein, we extend these findings to show that HR can modulate the p53 target genes PUMA , GADD45A , and CDKN1A as well as protein levels of other p53 downstream effectors including Survivin and Stathmin 1.…”

Section: Discussionmentioning

confidence: 99%

Hairless regulates p53 target genes to exert tumor suppressive functions in glioblastoma

Brook

Palade

Maatough

et al. 2018

J of Cellular Biochemistry

Self Cite

View full text Add to dashboard Cite

Glioblastoma (GBM) is the most common malignant brain tumor and is associated with a poor prognosis, with most patients living less than a year after diagnosis. Given that GBM nearly always recurs after conventional treatments, there is an urgent need to identify novel molecular targets. Hairless (HR) is a nuclear factor enriched in the skin and has been previously implicated in hair cycling. HR is also highly expressed in the brain, but its significance is unknown. We found that human hairless gene (HR) expression is significantly decreased in all GBM subtypes compared with normal brain tissue and is predictive of prognosis, which suggests that loss of HR expression can contribute to GBM pathogenesis. HR was recently discovered to bind to and regulate p53 responsive elements, and thus we hypothesized that HR may have a tumor suppressive function in GBM by modulating p53 target gene expression. We found that HR indeed regulates p53 target genes, including those implicated in cell cycle progression and apoptosis in the GBM-derived U87 cell line, and restoring HR expression triggered G2/M arrest and apoptosis. An analysis of sequenced genomes from patients with GBM revealed 10 HR somatic mutations in patients with glioma, two of which are located in the histone demethylase domain of HR. These two mutations, P996S and K1004N, were reconstructed and found to have impaired p53 transactivating properties. Collectively, the results of our study suggest that HR has tumor suppressive functions in GBM, which may be clinically relevant and a potential avenue for therapeutic intervention.

show abstract

“…There is clear evidence showing that HR interacts with HDACs, which partly accounts for its role in transcriptional repression ( 87 , 110-112 ). A recent study has shown that HR recognizes and binds to TP53-response elements, therefore regulating several key TP53 target genes ( PUMA , GADD45A , CDKN1A ) and downstream effectors ( BIRC5 and STMN1 ) ( 109 , 113 ). These findings suggest a possible crosstalk between HR and p53 tumor-suppressor activities.…”

Section: Transcriptional Regulation By Hairlessmentioning

confidence: 99%

Control of Breast Cancer Pathogenesis by Histone Methylation and the Hairless Histone Demethylase

et al. 2021

View full text Add to dashboard Cite

Breast cancer is a highly heterogeneous disease, encompassing many subtypes that have distinct origins, behaviors and prognoses. Although traditionally seen as a genetic disease, breast cancer is now also known to involve epigenetic abnormalities. Epigenetic regulators, such as DNA methyltransferases and histone modifying enzymes, play essential roles in gene regulation and cancer development. Dysregulation of epigenetic regulator activity has been causally linked with breast cancer pathogenesis. Hairless (HR) encodes a 130 kDa transcription factor that is essential for development and tissue homeostasis. Its role in transcription regulation is partly mediated by its interaction with multiple nuclear receptors, including thyroid hormone receptor, retinoic acid receptor-related orphan receptors, and vitamin D receptor. HR has been studied primarily in epidermal development and homeostasis. Hr-mutant mice are highly susceptible to UV- or carcinogen-induced skin tumors. Besides its putative tumor suppressor function in skin, loss of HR function has also been implicated to increase leukemia susceptibility and promote the growth of melanoma and brain cancer cells. HR has also been demonstrated to function as a histone H3 lysine 9 (H3K9) demethylase. Recent genomics studies have identified HR mutations in a variety of human cancers including breast cancer. The anticancer function and mechanism of action by HR in mammary tissue remains to be investigated. Here, we review the emerging role of HR, its histone demethylase activity and histone methylation in breast cancer development and potential for epigenetic therapy.

show abstract

The Mammalian Hairless Protein as a DNA Binding Phosphoprotein

Cited by 6 publications

References 45 publications

Human Hairless Protein Roles in Skin/Hair and Emerging Connections to Brain and Other Cancers

Human Hairless Protein Roles in Skin/Hair and Emerging Connections to Brain and Other Cancers

Hairless regulates p53 target genes to exert tumor suppressive functions in glioblastoma

Control of Breast Cancer Pathogenesis by Histone Methylation and the Hairless Histone Demethylase

Contact Info

Product

Resources

About