The leukemia-associated Rho guanine nucleotide exchange factor LARG is required for efficient replication stress signaling

Beveridge, Ryan; Staples, Christopher J.; Patil, Abhijit A.; Myers, Katie; Skehel, J. Mark; Boulton, Simon J.; Collis, Spencer J.

doi:10.4161/15384101.2014.956529

Cited by 7 publications

(5 citation statements)

References 50 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Recently a study revealed a crosstalk between ATR and Rho signaling. Alterations in the Rho pathway resulted in reduced ATR signaling and ATR defects reduced active RhoA and phosho-myosin light chain 2, implying defective Rho signaling [96] . Another novel role of ATR is in regulating leptin-dependent STAT3 signaling, suggesting a potential involvement in maintenance of cellular energy balance [97] .…”

Section: Non-canonical Substrates For Atr Activationmentioning

confidence: 99%

ATR-mediated regulation of nuclear and cellular plasticity

2016

View full text Add to dashboard Cite

ATR (Ataxia Telangiectasia and Rad3-related) is a member of the Phosphatidylinositol 3-kinase-related kinases (PIKKs) family, amongst six other vertebrate proteins known so far. ATR is indispensable for cell survival and its essential role is in sensing DNA damage and initiating appropriate repair responses. In this review we highlight emerging and recent observations connecting ATR to alternative roles in controlling the nuclear envelope, nucleolus, centrosome and other organelles in response to both internal and external stress conditions. We propose that ATR functions control cell plasticity by sensing structural deformations of different cellular components, including DNA and initiating appropriate repair responses, most of which are yet to be understood completely.

show abstract

Section: Non-canonical Substrates For Atr Activationmentioning

confidence: 99%

ATR-mediated regulation of nuclear and cellular plasticity

2016

View full text Add to dashboard Cite

show abstract

“…Full-length EBLN1 was cloned from genomic DNA from HeLa cells and BDV N was cloned from a pCDFDuet-1 plasmid containing full-length BDV N. Each gene was cloned into the Gateway entry vector pDONR221 (Life Technologies) following a PCR reaction with the following primer sets; EBLN1_F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTGTCCCGCCCAAGAAACAAC and EBLN1_R:GGGGACCACTTTGTACAAGAAAGCTGGGTTTATTCAAATCCCGAAATCCC or BDV N_F: CTTTATGCGACTCCTGATTAGG and BDV N_R: CGGCCGATATCCAATTGAGAT. Purified pDONR221-EBLN1 and pDONR221-BDV N were independently mixed with LR clonase and either FLAG-pDEST/FRT/TO or GFP-pDEST/FRT/TO to generate FLAG- or GFP-tagged tetracycline inducible stable HeLa and HEK293 cell lines as previously described 35 . All plasmids were fully sequence verified using a range of external and internal sequencing primers.…”

Section: Methodsmentioning

confidence: 99%

The bornavirus-derived human protein EBLN1 promotes efficient cell cycle transit, microtubule organisation and genome stability

Myers¹,

Barone²,

Ganesh³

et al. 2016

Sci Rep

Self Cite

View full text Add to dashboard Cite

It was recently discovered that vertebrate genomes contain multiple endogenised nucleotide sequences derived from the non-retroviral RNA bornavirus. Strikingly, some of these elements have been evolutionary maintained as open reading frames in host genomes for over 40 million years, suggesting that some endogenised bornavirus-derived elements (EBL) might encode functional proteins. EBLN1 is one such element established through endogenisation of the bornavirus N gene (BDV N). Here, we functionally characterise human EBLN1 as a novel regulator of genome stability. Cells depleted of human EBLN1 accumulate DNA damage both under non-stressed conditions and following exogenously induced DNA damage. EBLN1-depleted cells also exhibit cell cycle abnormalities and defects in microtubule organisation as well as premature centrosome splitting, which we attribute in part, to improper localisation of the nuclear envelope protein TPR. Our data therefore reveal that human EBLN1 possesses important cellular functions within human cells, and suggest that other EBLs present within vertebrate genomes may also possess important cellular functions.

show abstract

“…Human Tel2 also forms a complex with ATR-ATRIP and promotes the interaction between ATRIP and its activator TopBP1 for the replication checkpoint [34]. Human Tel2 has also been found to interact with LARG(Rho-guanine nucleotide exchange factor) protein, and depletion of LARG causes a replication checkpoint defect [126]. In budding yeast, although the tel2-1 mutant described above has moderately reduced Tel1(ATM) and Mec1(ATR), the mutation eliminates specifically the Tel1 kinase signaling at the sites of strand breaks.…”

Section: Ttt May Regulate the Dna Replication Checkpointmentioning

confidence: 99%

TTT (Tel2-Tti1-Tti2) Complex, the Co-Chaperone of PIKKs and a Potential Target for Cancer Chemotherapy

Bhadra

2023

IJMS

View full text Add to dashboard Cite

The heterotrimeric Tel2-Tti1-Tti2 or TTT complex is essential for cell viability and highly observed in eukaryotes. As the co-chaperone of ATR, ATM, DNA-PKcs, mTOR, SMG1, and TRRAP, the phosphatidylinositol 3-kinase-related kinases (PIKKs) and a group of large proteins of 300–500 kDa, the TTT plays crucial roles in genome stability, cell proliferation, telomere maintenance, and aging. Most of the protein kinases in the kinome are targeted by co-chaperone Cdc37 for proper folding and stability. Like Cdc37, accumulating evidence has established the mechanism by which the TTT interacts with chaperone Hsp90 via R2TP (Rvb1-Rvb2-Tah1-Pih1) complex or other proteins for co-translational maturation of the PIKKs. Recent structural studies have revealed the α-solenoid structure of the TTT and its interactions with the R2TP complex, which shed new light on the co-chaperone mechanism and provide new research opportunities. A series of mutations of the TTT have been identified that cause disease syndrome with neurodevelopmental defects, and misregulation of the TTT has been shown to contribute to myeloma, colorectal, and non-small-cell lung cancers. Surprisingly, Tel2 in the TTT complex has recently been found to be a target of ivermectin, an antiparasitic drug that has been used by millions of patients. This discovery provides mechanistic insight into the anti-cancer effect of ivermectin and thus promotes the repurposing of this Nobel-prize-winning medicine for cancer chemotherapy. Here, we briefly review the discovery of the TTT complex, discuss the recent studies, and describe the perspectives for future investigation.

show abstract

The leukemia-associated Rho guanine nucleotide exchange factor LARG is required for efficient replication stress signaling

Cited by 7 publications

References 50 publications

ATR-mediated regulation of nuclear and cellular plasticity

ATR-mediated regulation of nuclear and cellular plasticity

The bornavirus-derived human protein EBLN1 promotes efficient cell cycle transit, microtubule organisation and genome stability

TTT (Tel2-Tti1-Tti2) Complex, the Co-Chaperone of PIKKs and a Potential Target for Cancer Chemotherapy

Contact Info

Product

Resources

About